ID: 1057725399

View in Genome Browser
Species Human (GRCh38)
Location 9:97564723-97564745
Sequence TGTGATCCCGGGGCAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057725387_1057725399 16 Left 1057725387 9:97564684-97564706 CCCAAGCTGTCTGCCCTTTTCTC 0: 1
1: 0
2: 0
3: 33
4: 357
Right 1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG No data
1057725386_1057725399 28 Left 1057725386 9:97564672-97564694 CCAAAGCGATATCCCAAGCTGTC 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG No data
1057725388_1057725399 15 Left 1057725388 9:97564685-97564707 CCAAGCTGTCTGCCCTTTTCTCT 0: 1
1: 0
2: 7
3: 48
4: 693
Right 1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG No data
1057725390_1057725399 2 Left 1057725390 9:97564698-97564720 CCTTTTCTCTGTGCACATTTCCT 0: 1
1: 0
2: 5
3: 86
4: 697
Right 1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG No data
1057725389_1057725399 3 Left 1057725389 9:97564697-97564719 CCCTTTTCTCTGTGCACATTTCC 0: 1
1: 0
2: 4
3: 61
4: 542
Right 1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057725399 Original CRISPR TGTGATCCCGGGGCAGGGGA GGG Intronic
No off target data available for this crispr