ID: 1057725985

View in Genome Browser
Species Human (GRCh38)
Location 9:97568514-97568536
Sequence ACAGGGAAGCAGAAAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057725978_1057725985 1 Left 1057725978 9:97568490-97568512 CCTCGAAAGATGGGTAGAGCTTG 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG No data
1057725977_1057725985 2 Left 1057725977 9:97568489-97568511 CCCTCGAAAGATGGGTAGAGCTT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057725985 Original CRISPR ACAGGGAAGCAGAAAGGGAA GGG Intronic
No off target data available for this crispr