ID: 1057727598

View in Genome Browser
Species Human (GRCh38)
Location 9:97579101-97579123
Sequence CACGGCAGGCAGAGGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057727598_1057727607 18 Left 1057727598 9:97579101-97579123 CCAGTGTCCCTCTGCCTGCCGTG 0: 1
1: 0
2: 1
3: 26
4: 270
Right 1057727607 9:97579142-97579164 GTCTGAACCCAGATGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057727598 Original CRISPR CACGGCAGGCAGAGGGACAC TGG (reversed) Intronic
900119174 1:1041255-1041277 CACGGCAGGTCGCGGGGCACAGG - Exonic
900155808 1:1202880-1202902 CAAGGGTGGCACAGGGACACTGG - Intergenic
900206890 1:1435440-1435462 CTCGGCCGGGAGAGGGAGACTGG + Intronic
900301709 1:1981243-1981265 CACTGCGGGCACAGGGGCACTGG - Intronic
900531412 1:3155237-3155259 CAAGGCAGGCGGTGGGACCCGGG + Intronic
900584794 1:3427615-3427637 CACAGGAGGCAGTTGGACACTGG + Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
900665764 1:3814517-3814539 CACAGCAGGCAGAAGCCCACTGG - Exonic
900735079 1:4294653-4294675 CAGGGCAGGGCCAGGGACACTGG - Intergenic
900740746 1:4329300-4329322 CACGGCAGGCACAGGCACCAGGG + Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
900972859 1:6001075-6001097 CACTGCAGGGAGAGGGACAAGGG + Intronic
901026533 1:6281328-6281350 CACGGCTGGGCGGGGGACACTGG + Intronic
901069309 1:6509299-6509321 CAGGACAGGCAGAGGGACAGGGG + Intronic
901952589 1:12760622-12760644 CAAGGCTGGCAGAGGCCCACAGG - Intronic
902039441 1:13482234-13482256 CAGGAGAGGCATAGGGACACAGG + Intronic
902632568 1:17714108-17714130 CTCGGCAGGCTGAAGGACCCAGG - Intergenic
902869854 1:19307409-19307431 CCCTGCAGGGAGAGGGACCCCGG + Exonic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903301750 1:22384107-22384129 AACAGAAGACAGAGGGACACAGG - Intergenic
904009041 1:27379643-27379665 CACGGCACACAGAGGGCCTCAGG + Exonic
904256891 1:29259934-29259956 CACGGCAGCCAGCGGGAAAGTGG - Exonic
905250723 1:36646519-36646541 CTGGGCATGCAGAGGGCCACAGG + Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905891668 1:41522041-41522063 CACGGCAGACAGAGACAGACAGG + Intronic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
907472199 1:54681088-54681110 CAGGCCAGGCAGAGGCACCCAGG + Intronic
909548184 1:76869326-76869348 CCCGGAAGGCAGAGGAAGACAGG - Intronic
910285891 1:85553579-85553601 GACAGCAGGCAGACAGACACAGG + Intronic
912507811 1:110168191-110168213 CATGCCAGGCACAGGGACTCAGG - Intronic
915117140 1:153608255-153608277 CAAGGCAGGAGGAGGGACCCAGG - Intronic
915493563 1:156265648-156265670 CACCACAGGCAGAGGGCCAAAGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
917328412 1:173857079-173857101 CATGGCAATCAGAAGGACACTGG - Intronic
917616873 1:176754897-176754919 CACTGCAGGCAGAGGAAGTCTGG + Intronic
919977102 1:202619792-202619814 CAGGGCAGGCAGGAGGACATTGG + Intronic
921266117 1:213421868-213421890 CACACTAGGCAGAGGGAGACGGG - Intergenic
923338840 1:232991248-232991270 CAAGCCTGGGAGAGGGACACTGG + Intronic
1062884696 10:1007318-1007340 CACGTCATGCAGTGGGAAACGGG - Intronic
1063451133 10:6151097-6151119 GACAGCAGGGAGACGGACACAGG + Intronic
1063619912 10:7637239-7637261 AACAGCAGGCAGAGGGGCAGTGG - Exonic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1067569386 10:47360410-47360432 CGGGGCAGACACAGGGACACAGG - Intergenic
1068727515 10:60319968-60319990 CACAGAAGGCTGAGGGAAACTGG - Intronic
1069554520 10:69389098-69389120 CACTGCAGTCAGAGAGCCACTGG - Intronic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1071208599 10:83312732-83312754 CAGGGCTGGCAGGGGGCCACTGG - Intergenic
1072237763 10:93467880-93467902 CACTGCAGGCAGAGGGTGCCAGG + Intronic
1073206352 10:101771346-101771368 CAAGGTAGGCAGAAGGCCACAGG - Intronic
1075790067 10:125077768-125077790 CACGGGAGGCAGAGGGCCAGGGG - Intronic
1075984710 10:126774734-126774756 CACAGCAGGCAGAGGGTCCGGGG - Intergenic
1076528795 10:131130519-131130541 GATGACAGGCAGAGGGACACAGG - Intronic
1076765646 10:132631483-132631505 TAAGGCGCGCAGAGGGACACGGG - Intronic
1077283551 11:1756172-1756194 CAGGTCAGGGAGGGGGACACAGG - Intronic
1077304979 11:1864913-1864935 ACAGGCAGGCAGAGGGTCACAGG + Intronic
1078196163 11:9138645-9138667 CACTGCGGGCAGAAGGACCCAGG + Intergenic
1078578143 11:12518340-12518362 CACTGTAGCCAGAGGGACAGAGG - Intronic
1080561178 11:33464626-33464648 CATGGCAGGGACAGGGACATAGG - Intergenic
1083263690 11:61536491-61536513 CAGGGCAGTCAGAGGGCCACTGG - Intronic
1084464175 11:69312671-69312693 CATGCCAGGCATGGGGACACAGG - Intronic
1084530261 11:69723148-69723170 CACGCCAGGGAGAGGGGCTCAGG + Intergenic
1085202378 11:74709293-74709315 CAGGGGAGGCAGCAGGACACAGG + Intronic
1087852236 11:103045423-103045445 AACGGCATGCGGAGGAACACTGG - Intergenic
1088755714 11:112883538-112883560 AGCGGCAGGAAGTGGGACACGGG + Intergenic
1089457615 11:118634625-118634647 CACGGCAGTCAGAGGTGCAGGGG - Intronic
1090796740 11:130141865-130141887 CACGGCTGCCAGATGGTCACTGG + Intronic
1092229599 12:6769219-6769241 CAAGGGAGGCGGAGGGACACAGG + Intronic
1092504644 12:9083997-9084019 CCCGGCAGGCTGAGGGAGAGTGG + Intronic
1093867360 12:24244558-24244580 CACAGTTGGCAGAGGGAAACCGG - Intergenic
1094536540 12:31326359-31326381 CGCGGCGGCCAGAGGGAAACGGG + Exonic
1094603967 12:31934590-31934612 CCCGGGAGGCAGGGAGACACAGG + Intergenic
1096137274 12:49212878-49212900 CACAGAAGGCAGACAGACACAGG + Intronic
1097051174 12:56224256-56224278 CAGGGCAGGCGGCGGGACGCAGG + Intronic
1097446001 12:59671631-59671653 CACTGTAGTCAAAGGGACACAGG - Intronic
1102484975 12:113249325-113249347 CACGGCAGACAGTGGGTCAGCGG + Intronic
1102873775 12:116434274-116434296 CACCAGAGGCAGAGGGACAGGGG - Intergenic
1104628158 12:130376936-130376958 CACAGCAGGCAGAGGAAACCAGG - Intergenic
1105401754 13:20102354-20102376 AACGGGAGGCAGAAGGGCACGGG + Intergenic
1113641571 13:111961377-111961399 CAGGGCTGGCAGAAGCACACTGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1116770714 14:49123955-49123977 CACTCCAGGCTGAGGGACAAGGG + Intergenic
1117372656 14:55093064-55093086 CCCAGCGGACAGAGGGACACAGG + Intergenic
1117966616 14:61213092-61213114 CACGGCAGGCAAAGAGACAAGGG - Intronic
1119968915 14:78947724-78947746 CAGGGCAGGCTGAGGGACCATGG - Intronic
1121231921 14:92364646-92364668 TGCAGCAGGCAGAGGGACAGAGG - Intronic
1121650498 14:95554500-95554522 TTCAGCAGCCAGAGGGACACTGG + Intergenic
1122986775 14:105215568-105215590 CACTGCAGGCACACAGACACAGG + Intronic
1124170272 15:27366821-27366843 CAAGGTGGGCAGGGGGACACGGG - Intronic
1124492763 15:30168176-30168198 CAGGGCAGGCAGGAGGACATTGG + Intergenic
1124750771 15:32370149-32370171 CAGGGCAGGCAGGAGGACATTGG - Intergenic
1130232741 15:82109195-82109217 CATGGAAGGGAGAGGGACAGAGG + Intergenic
1132931045 16:2459456-2459478 CACGGGAGGGAGTGGGTCACAGG - Intergenic
1134174012 16:11991416-11991438 CATGCCAGGCAGGGGGAGACAGG + Intronic
1135536946 16:23302140-23302162 CACGCCAGGTTCAGGGACACTGG - Intronic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1139302749 16:65959327-65959349 CAAGGCAGGCAAAGGGACCCAGG + Intergenic
1139596637 16:67962003-67962025 CACGGCTGGCAGGGGGGCAATGG + Intronic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1141691641 16:85600089-85600111 CATTGCAGCCAGAGAGACACGGG + Intergenic
1141760584 16:86026247-86026269 GGAGGCAGGCAGAGGGAGACAGG + Intergenic
1142246632 16:88973193-88973215 CACTCCAGGCGGTGGGACACAGG - Intronic
1142540554 17:655436-655458 CCAGGCAGACAGAGTGACACAGG - Intronic
1142540565 17:655506-655528 CCAGGCAGACAGAGTGACACAGG - Intronic
1142540570 17:655541-655563 CAAGGCAGACAGAGTGACACAGG - Intronic
1144877953 17:18412155-18412177 CACACCAGGCGCAGGGACACAGG - Intergenic
1145154276 17:20532270-20532292 CACACCAGGCGCAGGGACACAGG + Intergenic
1145224302 17:21115146-21115168 AAAAGCAGGCAGAGGAACACAGG - Intergenic
1145231144 17:21174197-21174219 CACGGCAGGCAGAGCCACTGAGG - Intronic
1146653313 17:34620571-34620593 CTGTGCAGGCACAGGGACACAGG + Intronic
1146823975 17:36007838-36007860 GACGGGAGGCAGAGAAACACTGG + Intergenic
1146890187 17:36501788-36501810 GAGGGCAGGCAGTGGGACACGGG - Intronic
1147044359 17:37742652-37742674 CAGGGCAGGGAGAGGGACTGGGG - Intronic
1147980303 17:44269947-44269969 TAGGGCAGGCAGAGGGGCAAGGG - Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149596521 17:57867652-57867674 CTCAGCAGCCAGAGGGAAACAGG - Intronic
1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG + Exonic
1151747464 17:76019046-76019068 CCCGGCAGGCAGAGGAAAAACGG - Exonic
1152307409 17:79529438-79529460 CACAGCAGACAGAGGGAGACTGG + Intergenic
1152354287 17:79799218-79799240 CGGGACAGGCAGAGGGACCCGGG - Intronic
1152907556 17:82977127-82977149 AAAGGGAGGCAGAGGAACACTGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155100600 18:22606771-22606793 CTGGGCAGGGAGAGAGACACAGG + Intergenic
1155259304 18:24025926-24025948 GACGGCAGGCAGCAGGACAGAGG + Intronic
1156450856 18:37265856-37265878 CAGGTCAGGCAGTAGGACACAGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1158434967 18:57428887-57428909 CCCGGCTGGAAGAGGGACGCGGG - Intergenic
1158933612 18:62344871-62344893 CCGTGCAGGCAGAGGGAGACTGG + Intronic
1160710760 19:549979-550001 CTCGGGAGGCTGAGGGAAACAGG - Intergenic
1160950751 19:1666075-1666097 CAGGGCAGGCCCAGGGGCACGGG + Intergenic
1161114085 19:2487397-2487419 GACCCCAGGCAAAGGGACACGGG + Intergenic
1165032043 19:33005021-33005043 GACGGCAGGCAGAAGGACTAAGG + Intronic
1165154319 19:33777993-33778015 CACCGCTGGGAGAGGGGCACTGG - Intergenic
1165461490 19:35946527-35946549 ACCAGCAGGCAGAGGGACAGGGG + Intergenic
1165825445 19:38703081-38703103 CACGGCTGGCTGATGGACTCTGG + Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166945603 19:46394176-46394198 CTTGGCAGCCAGAGGGACAGAGG + Intergenic
1167497575 19:49828575-49828597 CAGGCCAGGCAGAGAGAGACCGG - Intronic
925512226 2:4640887-4640909 CATGGCATGCAGATGGACAATGG - Intergenic
925891619 2:8439284-8439306 CAAGGTAGGCACAGTGACACAGG + Intergenic
926106585 2:10155927-10155949 CACCGCAGGCAGAGCCACTCAGG + Intronic
927490339 2:23517105-23517127 CACAGCGGGCACAGGGAGACAGG - Intronic
927784620 2:25965080-25965102 CAGGGCTGGCAGAGAAACACAGG - Intronic
930748390 2:54908005-54908027 CACAGCAGGCAGAGAGAAAAAGG + Intronic
932331397 2:70900351-70900373 CAAGCCCGGCAGAGGGAGACTGG - Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933969904 2:87461933-87461955 CAGAGCAGGCAGATGGTCACAGG + Intergenic
934765888 2:96879802-96879824 CCCGGCAGGCAGAGGGAGCTGGG - Intronic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936323877 2:111488563-111488585 CAGAGCAGGCAGATGGTCACAGG - Intergenic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
948496228 2:238351538-238351560 CACGGCAGGCACAGGGGCGCAGG + Intronic
948635204 2:239330196-239330218 CAGGAGAGCCAGAGGGACACTGG + Intronic
948789430 2:240369746-240369768 CTGGGCAGGGCGAGGGACACTGG + Intergenic
1169550402 20:6696156-6696178 AACCTCAGGCAGAGAGACACAGG + Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171389280 20:24790751-24790773 CATCCCAGGCAGAGCGACACTGG + Intergenic
1172040626 20:32042249-32042271 CACAGCTGTCAGAGGCACACTGG + Intergenic
1172922702 20:38499162-38499184 CAAGGGGGACAGAGGGACACAGG - Intronic
1173570749 20:44074508-44074530 CCCTGCAGGCAGAGTGAAACGGG - Intergenic
1173729397 20:45318000-45318022 CAGGGCAGGGACAGGGACTCAGG - Intergenic
1174164728 20:48576676-48576698 CACAGCAGGGAGAGGGGCATGGG - Intergenic
1175257348 20:57655360-57655382 CACCGGGGGCAGAGGGACAAAGG - Intronic
1175460114 20:59146142-59146164 CGGGGGTGGCAGAGGGACACCGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175629195 20:60518950-60518972 CTCGCCAGGCAAAGGGGCACTGG - Intergenic
1175912437 20:62411248-62411270 CAAGGCAGGAAGGGGGCCACTGG - Intronic
1176051697 20:63123276-63123298 CACTGCAGGCTGAGGGACAAGGG - Intergenic
1176081393 20:63275051-63275073 CACTCCAGGCAGCGGGGCACAGG + Intronic
1177688433 21:24470919-24470941 CACGGCAAGCAGAGAGAAAATGG + Intergenic
1179534383 21:42041952-42041974 CAGGGCAGGCTGAAGGACAAAGG + Intergenic
1180048139 21:45319048-45319070 CTCCTCAGGCAGAGGGAGACAGG + Intergenic
1180056547 21:45361959-45361981 CACGCCAGGCAGGGGGGCTCGGG - Intergenic
1180569559 22:16702476-16702498 GGAGGCAGGCAGAGGGACAGAGG - Intergenic
1180831911 22:18910880-18910902 CACGGCAGGCGGTGGAGCACCGG + Exonic
1181067935 22:20315462-20315484 CATGGCAGGCCGTGGAACACCGG - Exonic
1181629957 22:24145617-24145639 CACACCAGGCAGAGACACACGGG - Intronic
1182267655 22:29130759-29130781 CACAGAAGGCAGGAGGACACCGG + Intronic
1182347061 22:29673739-29673761 CACGGCCATCAGAGGGACAGGGG - Intronic
1182703461 22:32259943-32259965 CAAGGCAGACAGGGGAACACAGG + Intergenic
1183661724 22:39225317-39225339 CAGGCCAAGCAGAGAGACACAGG + Intronic
1183674337 22:39291273-39291295 CACTGGAGGAACAGGGACACAGG + Intergenic
1183936190 22:41263788-41263810 CACGTCAGGCCGAGGGACACAGG + Intronic
1183959237 22:41401225-41401247 CACGGCAAGCACAGGGGCATGGG + Intergenic
1184595383 22:45510758-45510780 CAAGGCATGCAGAGAAACACAGG - Intronic
1184670604 22:46010617-46010639 CATGGCAGGCAGAGTCACATGGG - Intergenic
1184716965 22:46287978-46288000 AACAGCAGGCTGAGGGGCACAGG + Intronic
1184784440 22:46664902-46664924 CGCAGCAGGCACAGGGCCACAGG - Intronic
1185205050 22:49533141-49533163 CACAGCAGGGCGAGGGACCCTGG - Intronic
1203281989 22_KI270734v1_random:136151-136173 CACGGCAGGCGGTGGAGCACCGG + Intergenic
950808795 3:15632063-15632085 CACGGCAGGCAGAGAGCCTGAGG - Intronic
953140708 3:40226916-40226938 CAGGGCAGGCTGTGGGAGACAGG - Intronic
954333114 3:49901297-49901319 CACAGCAGGCCCAGGGCCACAGG + Intronic
956188804 3:66588359-66588381 CACTGCAGTCAGAGCAACACGGG - Intergenic
957879967 3:86199733-86199755 CACAGCAGGCAGGGACACACAGG - Intergenic
959604037 3:108222506-108222528 CAGGGCAAGAAGAGGGCCACAGG - Exonic
960140048 3:114142906-114142928 CATTGCAGGCAGAGTGACACTGG + Intronic
961368480 3:126415733-126415755 CAGGACAGCAAGAGGGACACGGG + Intronic
961768262 3:129229018-129229040 CACCCCAGGCAGAGGGAGAAAGG - Intergenic
962853766 3:139326812-139326834 CCTGGCTGGCAGTGGGACACAGG + Intronic
962884813 3:139614441-139614463 CAAGGCAGTGAGAGAGACACTGG + Intronic
964026045 3:152076274-152076296 CAAGGCAGGCATAGGGAGAATGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
968229490 3:196996938-196996960 CCGGGCAGGAAGAGGGAGACGGG + Intronic
968636795 4:1684913-1684935 CACAGCAGGCCCAGGGAGACCGG + Intergenic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
968813627 4:2810923-2810945 CACAGCAGGCAGACAGACAGAGG - Intronic
968895269 4:3397241-3397263 CTCGGCACCCAGAGGCACACAGG - Intronic
969054703 4:4394337-4394359 CATGGCAGGCACAGGTACCCCGG + Intronic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
971728902 4:30350538-30350560 CAGAGCAGGGAGAGGGACAGAGG - Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
982467694 4:155750693-155750715 CAAGGAAGGCAGAGGGCCTCTGG - Intergenic
985670393 5:1203772-1203794 CACTGCAGCCAGAGGGACTCGGG + Intronic
986297902 5:6454934-6454956 TAGGGCAGGCAGGAGGACACAGG + Intronic
992143200 5:73819927-73819949 TACGCAAGGCAGAGTGACACAGG - Intronic
992150859 5:73901359-73901381 CACGGCAGTCAGTGGGGCAAAGG + Intronic
997353299 5:133246239-133246261 CACCTCAGGCTGAGGGACTCTGG + Intronic
997439825 5:133901276-133901298 CTGGGCAGGCAGAGGGTCAGAGG - Intergenic
998534303 5:142915287-142915309 CACGCCATGCAGAGGGAACCAGG - Intronic
999699928 5:154218923-154218945 CACTGCAGGGAAAAGGACACAGG - Intronic
1000328938 5:160192640-160192662 CAGGGCAGCCACAGAGACACAGG + Intronic
1001422678 5:171599469-171599491 CACTGCAGACAGAGGGTCCCAGG - Intergenic
1001542603 5:172550082-172550104 CACGGCGGGCAGTGGGGCAGAGG + Intergenic
1002198711 5:177514836-177514858 CGCTGCAGGCAGAGGGACAAAGG + Exonic
1002814741 6:669270-669292 CAGGGCTGGCAGGGGGCCACAGG - Intronic
1002919263 6:1554844-1554866 CAAGGGAGGCACAGGGACTCCGG - Intergenic
1006632789 6:35441471-35441493 CAGGGCAGGGACAGGGACAGAGG - Intergenic
1007173202 6:39878945-39878967 CACGTCACGCACACGGACACTGG - Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008789453 6:55212560-55212582 CACGCCAGGAAGAGGGAAAGAGG - Intronic
1015267282 6:131301471-131301493 CACAGCAGGCAGTGTGGCACAGG - Intergenic
1016289316 6:142510595-142510617 CACAGCAGTCTGAGGCACACTGG + Intergenic
1018843017 6:167532069-167532091 CGCGGCAGGCACTGAGACACTGG + Intergenic
1019150182 6:170000484-170000506 CAGCGCAAGCAGAGGGACATGGG - Intergenic
1019315921 7:386623-386645 CACGGGAGGCTGAGGGAATCAGG + Intergenic
1019413085 7:915026-915048 CACGCCAGCCAGAGGGCCTCGGG - Intronic
1019662461 7:2232526-2232548 CACGGTAGGCAGCGGGACCCCGG + Intronic
1022617955 7:31951822-31951844 TCCAGCAGGCAGAGGGACAGAGG - Intronic
1026250959 7:68670294-68670316 CACAGCAGACAGAGTGACCCTGG - Intergenic
1027457603 7:78413019-78413041 TTCTGCAGGCAGAGGGAGACAGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029543093 7:101196099-101196121 CACTGCAGGGAGAGGGAGACAGG + Exonic
1029544872 7:101205385-101205407 CAAGGCAGGCGGAGGATCACTGG - Intergenic
1031080401 7:117252042-117252064 CAAGCCAGGCAGAGGGTCATGGG - Intergenic
1032073942 7:128827470-128827492 CAAGCCAGGCAGGGGCACACAGG - Intergenic
1034420862 7:150989913-150989935 CACTGAAGGCTGAGGGTCACAGG - Intergenic
1036691243 8:10946133-10946155 ACCTGCAGGCAGAGTGACACAGG - Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1036749564 8:11435248-11435270 CTCTGCAGGGAGAGGGACAAAGG - Intronic
1038210487 8:25515004-25515026 GAAGGGAGGCAGAGGGTCACTGG - Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042113387 8:65405402-65405424 CACTGCAGGCAGTGGGGCACAGG - Intergenic
1044275744 8:90297612-90297634 CACTGCAGGCAGTGGCACAATGG + Intergenic
1047494810 8:125401980-125402002 CACCACAGCCAGAGGTACACCGG + Intergenic
1047799950 8:128298495-128298517 CAGGGCAGGGAGAGTGACTCAGG - Intergenic
1047957121 8:129984517-129984539 CAGGGCTGGCACAGGAACACTGG + Intronic
1048331261 8:133472225-133472247 CCTGGCAGGAACAGGGACACAGG - Intronic
1049192148 8:141294448-141294470 CACTGCAGGCAGATGGCCAGTGG + Intronic
1049211964 8:141391134-141391156 CTCAGCAGCCAGAGGGACCCCGG - Intergenic
1049339858 8:142106297-142106319 ACAGGCAGACAGAGGGACACAGG + Intergenic
1053469380 9:38335330-38335352 CAGGGCAGGAAGGGAGACACTGG - Intergenic
1057144575 9:92749319-92749341 CACAGGAGGCTGAGGGGCACTGG + Intronic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1059525695 9:114989195-114989217 CACCACAAGCAGAGGGACATAGG - Intergenic
1060210425 9:121706901-121706923 TACGGGAGGGAGAGGGAAACAGG + Intronic
1060766162 9:126296269-126296291 CCCTGCAGGAAGAGGGACAAGGG + Intergenic
1061201414 9:129140582-129140604 AAAGGCAGGCAGATGGGCACTGG - Intronic
1061219752 9:129243304-129243326 CAAGGCAGGCAGAGAAACAGAGG - Intergenic
1061220306 9:129246695-129246717 CCGGGAAGGCAGAGGGACAGAGG + Intergenic
1061271855 9:129548306-129548328 CACGGCCTGGAGAGGGCCACTGG + Intergenic
1061273173 9:129555394-129555416 CACTGCAGGGACAGGGACAGGGG + Intergenic
1061487230 9:130926089-130926111 CACGCCCCACAGAGGGACACAGG + Intronic
1061875679 9:133542404-133542426 CAGGGCATGCAGAGGGAGAGTGG + Intronic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062712816 9:137985977-137985999 CACAGCAGGAAGAGCTACACCGG - Intronic
1185569958 X:1127455-1127477 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570029 X:1127813-1127835 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570043 X:1127885-1127907 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570051 X:1127921-1127943 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570074 X:1128029-1128051 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570083 X:1128065-1128087 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570091 X:1128101-1128123 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570121 X:1128245-1128267 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570142 X:1128353-1128375 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570150 X:1128389-1128411 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570180 X:1128533-1128555 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570210 X:1128677-1128699 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570234 X:1128783-1128805 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570250 X:1128855-1128877 CACTGCAGGGACAGGGACAGGGG + Intergenic
1189760322 X:44315523-44315545 CAAGGCAGAGAGAGGGAGACTGG + Intronic
1190877084 X:54467731-54467753 CTCGGCAGGCAGGTGGACAGGGG + Intronic
1191169839 X:57432361-57432383 CACGGCAAGAACAAGGACACAGG + Intronic
1192996794 X:76520722-76520744 GACTGCAGGCAAAGGGATACAGG + Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1200068838 X:153517978-153518000 GGCGGCAGGTAGGGGGACACGGG + Intronic