ID: 1057730112

View in Genome Browser
Species Human (GRCh38)
Location 9:97601161-97601183
Sequence AAGGAGAAGCCAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057730112 Original CRISPR AAGGAGAAGCCAAATGGGGA TGG (reversed) Exonic
900132196 1:1091902-1091924 AAGGTGGAGCCAAATGGAGGTGG + Intronic
900312884 1:2042978-2043000 AAGGCAAAGACAACTGGGGAGGG + Intergenic
900874082 1:5329098-5329120 AAGGAGAAAACAAATGGACATGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903953928 1:27012205-27012227 ATGGAAAAGCCAGGTGGGGAAGG + Intronic
904282357 1:29429491-29429513 AACATGAAGCCAAATGGAGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904352430 1:29917378-29917400 AAGGAGAAGGGAAAGGGAGAAGG - Intergenic
904865830 1:33578176-33578198 AAGTTGAAGCCATATGTGGAGGG - Intronic
905256465 1:36688548-36688570 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905256486 1:36688602-36688624 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905256507 1:36688656-36688678 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905891327 1:41520323-41520345 GAGGAAAACCCAAATTGGGAAGG - Intronic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
906804214 1:48764466-48764488 GAATAGAAGCCAAATGGGGAAGG + Intronic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907579132 1:55556126-55556148 AATGAGAAAGCAAATGGGGCAGG - Intergenic
907873692 1:58465964-58465986 AAGCAGAAGCCAGATGTGCAGGG + Intronic
908262399 1:62349380-62349402 GGGGAGGAGCGAAATGGGGAGGG + Intergenic
908274576 1:62456844-62456866 AAGGGGAAACCAAAAGTGGAGGG + Intronic
909470989 1:76027878-76027900 AAGGAGAAGCCAAATCAGAGTGG + Intergenic
911058561 1:93728579-93728601 ATGGGGAAGCCAAAAAGGGATGG + Intronic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911782644 1:101902162-101902184 ACGTGGAAGCCAAATAGGGAGGG + Intronic
912661052 1:111530921-111530943 AAGGAGAGGAGAAATAGGGATGG - Intronic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913331413 1:117671223-117671245 AAAAAGAAGCCAGAGGGGGAAGG + Intergenic
914681940 1:149944680-149944702 AAGGAGGAGGCAGCTGGGGATGG - Exonic
915562223 1:156693981-156694003 AAGGGCAAGGCAAGTGGGGAGGG - Intergenic
915740712 1:158116459-158116481 GAGCAGAAGCCAAATGGAGAAGG + Intergenic
916430373 1:164722234-164722256 AATGAGGATCCAAATGGGAAAGG - Intronic
918264470 1:182828439-182828461 AAGGAGAAGCCAAAGGTGTCAGG - Intronic
919082842 1:192887287-192887309 AATGAAAAGACACATGGGGAAGG + Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919591604 1:199510799-199510821 AAGGGGGAGCCAACAGGGGATGG - Intergenic
919755753 1:201065074-201065096 AAGGAAAAGCCACGTGGGGTAGG + Intronic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920590833 1:207217026-207217048 ATGAAGCAGCCAAATAGGGAGGG + Intergenic
921319117 1:213920036-213920058 GAGGATATGGCAAATGGGGAAGG - Intergenic
921369914 1:214411289-214411311 AAAAAGCAGCCAAATGGGAAAGG + Intronic
922482969 1:225951786-225951808 AATGAAATGCCAAAGGGGGAAGG - Intergenic
922507338 1:226134170-226134192 TGGGAGAAGACACATGGGGAAGG - Intergenic
922572185 1:226640695-226640717 AAGGAGAAGGCGGATGGGTACGG + Intronic
923235776 1:232031428-232031450 AAGGAGAAGGGAAAAGGGAAAGG + Intronic
923517004 1:234706441-234706463 AAGGAGAAGCCTCATGGACAAGG + Intergenic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924387407 1:243511495-243511517 GAGGAGAAGACATATAGGGAAGG + Intronic
1063061139 10:2553637-2553659 GAGGAGAAGCCAGATGGATAGGG + Intergenic
1063280553 10:4625098-4625120 AAGGTGAAGCCAAAGAGAGATGG - Intergenic
1063331604 10:5165178-5165200 AAAGACAACCCAAATGGAGAGGG - Intergenic
1064832842 10:19490487-19490509 CAGAAGAAGCCAAGTGGGGCGGG + Intronic
1065229228 10:23579912-23579934 AAGCTGAAGCCAAACTGGGAAGG + Intergenic
1065570574 10:27067676-27067698 AAGGACAGGACCAATGGGGATGG + Intronic
1065786919 10:29224483-29224505 AGGAAGTAGCTAAATGGGGAGGG + Intergenic
1066086516 10:31977065-31977087 AAGGAGAAGCCAAATAGCACAGG - Intergenic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067306603 10:45070569-45070591 AAGGACAACCCAAATGTGTAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070305950 10:75239343-75239365 AATGAGTAGCAAAAAGGGGAGGG - Intergenic
1071594203 10:86907083-86907105 AAGGGGAAGGCAACTGGTGAAGG - Intronic
1072498658 10:95989611-95989633 AAGGAGAAGCCCAGGAGGGAGGG + Intronic
1072749320 10:97965929-97965951 AAGGAGATGACAGATGGGGCAGG + Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073714165 10:106083468-106083490 AAGGAGAATCTAAAAGGGAAGGG - Intergenic
1074831356 10:117251755-117251777 AAGGAAAAGCCATGTGGGAATGG + Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075571262 10:123548006-123548028 TAGGAGATGACAAAGGGGGAGGG - Intergenic
1076028168 10:127134459-127134481 CAGCAGAAGATAAATGGGGAGGG - Intronic
1076182657 10:128422597-128422619 AAGAAGATGACAAAGGGGGATGG + Intergenic
1076267387 10:129119346-129119368 AGGCAGAAGCCACATGGGGGTGG + Intergenic
1076370822 10:129951996-129952018 CCGGCGAAGCCAAATGGGGCCGG + Intronic
1077371903 11:2186234-2186256 AAGCAGAGGTCAGATGGGGAGGG - Intergenic
1077398045 11:2336078-2336100 AAGGACAACCCAAATGCGTAAGG + Intergenic
1077398820 11:2342375-2342397 AAGGACAACCCAAATGCGTAAGG + Intergenic
1077412669 11:2410813-2410835 TAGGAGCGGCCAAATGGCGAAGG + Intronic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077559571 11:3250556-3250578 AAGGAGGACCCAAATGCGTAAGG - Intergenic
1077573705 11:3360882-3360904 AAGGAGAAGCCAAGAGCTGAGGG - Intronic
1078703880 11:13718888-13718910 ATGGAGAGGCCACATGGAGAGGG - Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079722843 11:23840992-23841014 AAGGAGCATCCAAATTGGAAAGG - Intergenic
1079788739 11:24709477-24709499 AAGGAGAAGCTAAAAGAGAAAGG + Intronic
1079984602 11:27187426-27187448 AAGGTGATGCGAAGTGGGGAGGG - Intergenic
1080401418 11:31939879-31939901 AAGGTGAAGTCAGCTGGGGATGG - Intronic
1080576080 11:33600437-33600459 ACAGTGAAGCCATATGGGGAAGG + Intronic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081489696 11:43557882-43557904 GTGGAGAAGCTAAATGGGGCAGG + Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082811540 11:57481983-57482005 AAGGAAAATGCAAAGGGGGAAGG + Intergenic
1083446042 11:62708597-62708619 AAAGAGAACCCATTTGGGGAGGG + Intronic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084201600 11:67562565-67562587 TAGGAGCAGACAAATGGGGCCGG + Intergenic
1085463456 11:76708907-76708929 AACAAGAAGCCAAAAAGGGATGG - Intergenic
1085887478 11:80537124-80537146 AAGGAGAAGCCAGCTGGGTGTGG - Intergenic
1086424018 11:86666268-86666290 ACGCAGAAGCCAATTGGGAAGGG - Intronic
1086496156 11:87406342-87406364 GAGAAGAAGACTAATGGGGAAGG + Intergenic
1086502192 11:87464819-87464841 GAGGAGAAGACACATGGGGAGGG + Intergenic
1086924931 11:92630069-92630091 AGGTAGAAGCCAGATGGAGAAGG - Intronic
1087162648 11:94964695-94964717 AAGGAGCAGCCAGTTGGGAAGGG - Intronic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088091880 11:106050644-106050666 AAGGAGAGGCCAAATATGAAAGG + Intergenic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088177504 11:107070537-107070559 AAGGGGAAGCCAACTGGACAAGG + Intergenic
1088301837 11:108366303-108366325 AAGAAGAAGCCCAATGGATAGGG - Exonic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088735805 11:112726840-112726862 AAGGAGAAATCAAATGTGCATGG - Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089591089 11:119541018-119541040 AAGAAGGAGAGAAATGGGGAAGG + Intergenic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1089746996 11:120624440-120624462 AAGGAGGAGGCCAAAGGGGATGG - Intronic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1091589028 12:1832070-1832092 AAGAAGAAGTCAAATGGGTTAGG + Intronic
1092033475 12:5309631-5309653 AAGGAGGAGTCAAAAGGTGAGGG - Intergenic
1092974337 12:13729804-13729826 AAGAGGAAGCCATATGGGGAGGG + Intronic
1094492929 12:30972482-30972504 AAGTAGAACACAAATGGGGTTGG + Intronic
1094848128 12:34370366-34370388 AAGGAAAACACAAATGGTGAGGG - Intergenic
1095163935 12:38949502-38949524 AGGGAGAAGCTAAATTGGCATGG + Intergenic
1095263730 12:40128880-40128902 AAGTAGAAGGCAGATGGGAAAGG - Intergenic
1095969824 12:47894069-47894091 AGGGAGATGACAAATGGGTAGGG - Intronic
1098366818 12:69712156-69712178 AATCAGAAGCCACAGGGGGAGGG + Intergenic
1098663439 12:73129755-73129777 AAAGAAAAGGCAAATGGGTAAGG - Intergenic
1099492741 12:83306979-83307001 AATGAGAAGCCAAATGTTAATGG + Intergenic
1100027041 12:90142948-90142970 ATGAAGAATCCAAATGGTGATGG - Intergenic
1100324926 12:93531649-93531671 AGGGAGAAGACACATGGAGAAGG - Intergenic
1100390570 12:94143024-94143046 AACGAGAAGCCAAAAGGCAAGGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100754510 12:97735525-97735547 AAGAAAAATCCAAATGGGTATGG - Intergenic
1101091240 12:101288048-101288070 AAGGAGAGGCAAAATGGCAAGGG - Intronic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1102108622 12:110347052-110347074 AAGAAGAAGCCAAGCGGGGCGGG - Exonic
1102320623 12:111930512-111930534 AAGGGAAAGCCAAATGGACAAGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1103539208 12:121654288-121654310 AACGACAAGCCCAACGGGGAGGG - Exonic
1103878845 12:124150381-124150403 AAGAGGAGGCCAGATGGGGAGGG + Intronic
1103896587 12:124277570-124277592 CAGGAGAAGCCCGACGGGGAGGG - Intronic
1104499293 12:129269371-129269393 AAGGAGAAGGCAAAGGGGAAGGG - Intronic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1106843546 13:33712268-33712290 AAGTAGAAGCCAAATGACAAAGG - Intergenic
1106903652 13:34381992-34382014 AAGGTGAAACCAAATGGGGCTGG - Intergenic
1108427621 13:50319657-50319679 GAGGAAAAGTCAAAGGGGGATGG + Intronic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108980927 13:56512718-56512740 AAGGACAACCCAAATGCGTAAGG + Intergenic
1111422072 13:88025066-88025088 AAAGAGAAGCCAAATGGCATTGG - Intergenic
1111671747 13:91340022-91340044 AAGGAGACGCCAAATTAGAATGG - Intergenic
1111873413 13:93863032-93863054 AAGGAGAGGCCAAAACTGGAAGG - Intronic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1114529954 14:23389373-23389395 AAGGTGAGGCCCAGTGGGGAGGG - Exonic
1115014838 14:28597889-28597911 AATGAGAAGACACATGGGAAGGG - Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1120024467 14:79567385-79567407 AATGGGAAACAAAATGGGGAAGG + Intronic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1120613594 14:86674106-86674128 GAGGAGGAGCCAAATGTGGTTGG - Intergenic
1120867306 14:89306660-89306682 AAGGAGAACCAAAATGGGCCGGG - Intronic
1120975330 14:90243170-90243192 AAAAAAAAGCCAAATGGGAAAGG + Intergenic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1122829202 14:104387551-104387573 CAGCAGACGCCACATGGGGATGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124894931 15:33767582-33767604 TAGGACAACTCAAATGGGGAAGG - Intronic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125937278 15:43648373-43648395 AAGGAGCAGCCACAAGGGCAGGG + Intronic
1125950175 15:43745789-43745811 AAGGAGCAGCCACAAGGGCAGGG + Intergenic
1126180507 15:45780820-45780842 AGGCAGAAGCCAAAGGGGGCAGG - Intergenic
1126245929 15:46505695-46505717 AAGGAAAAACCTAATGTGGATGG - Intergenic
1126372521 15:47962351-47962373 AAGGAGAGCACACATGGGGATGG - Intergenic
1127370467 15:58334086-58334108 AAGGAGAGGGCAAAAGGTGATGG + Intronic
1127412880 15:58726921-58726943 AAGGAGAAGACGAAGGGGAAGGG + Intronic
1127761115 15:62139985-62140007 AAGGTGAAGACAAATGCTGAGGG - Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1128037810 15:64541883-64541905 TAGTAGAAGCCAAAAGGGAAGGG - Intronic
1128053702 15:64684398-64684420 GAGGAGAAGCTAAAGAGGGAGGG + Exonic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128823910 15:70691931-70691953 AAGGAAATGCCAAAGGGGGTAGG + Intronic
1129661012 15:77552913-77552935 AAAGAGAAGCCAGCAGGGGAGGG + Intergenic
1129963297 15:79709630-79709652 GAGGGCAAGCCAAATCGGGAAGG + Intergenic
1130096305 15:80858762-80858784 AATAAGAAGCCAAAAGGAGAAGG - Intronic
1130312122 15:82765018-82765040 AGGGAGGAGCCTAATGGGGAGGG - Intronic
1131533750 15:93216524-93216546 AGGAAGAAGCCAAATTGTGAAGG - Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135987453 16:27194453-27194475 GAGGAGAAGGCCAAAGGGGAAGG + Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1139685643 16:68601277-68601299 AAAGAGAAGCCAAATGCAAAAGG + Intergenic
1139689996 16:68635018-68635040 GATGAGAAGACAAACGGGGATGG + Intergenic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1141777766 16:86135624-86135646 CAGGAAAAGCCACATGGTGATGG + Intergenic
1142957024 17:3529285-3529307 AAGGAGGAGCAAACTGGGGCTGG - Intronic
1143435736 17:6923352-6923374 CAGGAGAAGCAAACTGGGGGAGG + Intronic
1143531644 17:7508517-7508539 AAGGAGAACTCAACTGGGTATGG + Intronic
1143875657 17:9988785-9988807 AAGGGGATGCCAGATGTGGAGGG - Intronic
1144311130 17:14015302-14015324 AAGAAGAAGCCTCATGGGGTCGG + Intergenic
1144471250 17:15543337-15543359 AAGGATAAGCAAAATGGATAAGG + Intronic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1144925216 17:18801356-18801378 AAGGATAAGCAAAATGGATAAGG - Intronic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146916753 17:36682886-36682908 AAGGAGAAGGCACAAGGGGAGGG - Intergenic
1147203843 17:38822763-38822785 AAGAAGAAGCCAAGTGAGAAAGG + Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147759060 17:42785777-42785799 AAGAAAAAGAAAAATGGGGAGGG - Intronic
1147856174 17:43482125-43482147 AAGAGGAAGCGAAATGGGGAGGG + Intergenic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148211850 17:45813386-45813408 GAGGAGAAGCCAAATGAAAAGGG - Intronic
1148686024 17:49501757-49501779 AAGGATATACCACATGGGGAAGG - Intronic
1149147200 17:53508825-53508847 AAAGGGAATCCAAATGGGAAAGG + Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150222014 17:63501066-63501088 AGGGAGAAGTGACATGGGGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153496615 18:5705781-5705803 AAAGAGGAGCCAAGTGGGGTTGG - Intergenic
1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG + Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154156354 18:11947539-11947561 AAGCAGAAGCCCGTTGGGGAGGG - Intergenic
1155512117 18:26588686-26588708 AAGGAGGCGCCAACTTGGGAGGG + Intronic
1155706070 18:28814504-28814526 GAAGAGATGACAAATGGGGATGG + Intergenic
1155807111 18:30185151-30185173 AAGGGGAAGTGAAAAGGGGATGG - Intergenic
1155854828 18:30820096-30820118 CAGAAGAAGCCAAATCAGGACGG - Intergenic
1156152225 18:34255762-34255784 AAGGAAAAGCCCAAATGGGAAGG + Intergenic
1156369994 18:36464725-36464747 CAGGAGGAGGCAAAGGGGGAGGG + Intronic
1157484187 18:48075395-48075417 AAGGAGAAGCCAGATGGAAATGG + Intronic
1158375604 18:56859801-56859823 AAGTAGAAGCCATATGAAGAAGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159045639 18:63366883-63366905 AAGGCATGGCCAAATGGGGAAGG - Intronic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1161288340 19:3479973-3479995 AAGGAGGAGCCCAGAGGGGAGGG + Intronic
1161344768 19:3762830-3762852 TAAGAGGAACCAAATGGGGACGG + Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162042569 19:7979582-7979604 AAGGATAAGCCACCTGGGGCTGG + Intronic
1162100883 19:8337970-8337992 AAGGAGAGGCCATGTGTGGAGGG - Intronic
1162691536 19:12437794-12437816 AATCAAAAGCCATATGGGGATGG + Intronic
1162901101 19:13795847-13795869 GAGGAGAAGACAGGTGGGGAAGG - Intronic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165097352 19:33416894-33416916 CAGGAGATGACAAATGGGGCAGG + Intronic
1165320797 19:35084045-35084067 AAGGAGAAGCCAAATGTTCTAGG + Intergenic
1165327588 19:35123218-35123240 AGGGAGAGGGCAAATGGGGGCGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166415982 19:42595290-42595312 AGGGAAGAGCCAGATGGGGATGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167298028 19:48663292-48663314 GGGCAGAAGACAAATGGGGAGGG - Intronic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168485293 19:56756513-56756535 AATGAGAAGGCTAATGGGAATGG + Intergenic
1168707390 19:58477793-58477815 AAGGAGGAGCCCAATGTCGATGG + Exonic
925159419 2:1673574-1673596 AAGGAGAAGGCAGATAGTGAGGG + Intronic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
925669360 2:6294466-6294488 AAGGAGAAGCCACCCAGGGAAGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926412434 2:12618115-12618137 CAGGAGAAACCACATGGGGAGGG + Intergenic
926503458 2:13682350-13682372 AAGGACAACCCAAATGTGTAAGG + Intergenic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
928240801 2:29584050-29584072 AGGCAAAAGCCAAATGGGGTAGG + Intronic
928445442 2:31329768-31329790 AAAGAAAATCCAAATGGAGATGG + Intergenic
928822209 2:35374730-35374752 AAGGGGAACCCAAATAGGGCTGG + Intergenic
929061575 2:37930437-37930459 AAGGAAAAGCCACTTGGGGAAGG - Intronic
930266032 2:49200134-49200156 AAGGAGGAGCAAATTGGGGTAGG - Intergenic
930472104 2:51829824-51829846 AAGGAGAAGAGAAGAGGGGAGGG - Intergenic
931191389 2:60003647-60003669 AAAGAGTAGCCAAGTGTGGACGG - Intergenic
931295753 2:60923534-60923556 AAGGAGAAGCAAGTTTGGGAGGG - Exonic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931967677 2:67551338-67551360 AAGGAGAAGCAACAAGGAGAAGG + Intergenic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
933171671 2:79132312-79132334 GAGGGGAAGCAAAATGGGAAGGG - Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933403903 2:81833447-81833469 AAAGAGAATCTAAATTGGGAAGG + Intergenic
934067633 2:88354260-88354282 AAGGAGAAGCCATGTGTAGATGG + Intergenic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
936401941 2:112171309-112171331 ACTGAGAAGTCAAATGGAGAAGG + Intronic
936919519 2:117673431-117673453 AAGGAGCAGGCAACAGGGGAAGG + Intergenic
936927130 2:117748877-117748899 ATGGAGAAGCCAAATAGAGATGG + Intergenic
936996231 2:118416918-118416940 CAGGAGAAACCAAGAGGGGAGGG - Intergenic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937057660 2:118953016-118953038 AAGGACAACCCAAATGTGTAAGG - Intronic
937328316 2:121005634-121005656 AGGGAGATGCCAAATGGATAGGG + Intergenic
937578914 2:123459400-123459422 AGAAAGAAGCCAAGTGGGGAAGG - Intergenic
938571621 2:132566937-132566959 AGGAAGAAGGCAAATGGAGAAGG - Intronic
939361598 2:141179630-141179652 AAGGAAAAGGCAAATGTTGAAGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939838758 2:147161290-147161312 AAAGGGAATCCAAATGGGAAAGG - Intergenic
939893138 2:147760942-147760964 AAGGAGGAGTCAGATTGGGAAGG - Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
942249920 2:174038795-174038817 TCCCAGAAGCCAAATGGGGAGGG + Intergenic
942278997 2:174342419-174342441 AAGGAGAGGACAAAAGGGGTCGG - Intergenic
942843993 2:180400942-180400964 AAGGAGCAGCCAGATGGGTAAGG + Intergenic
943636541 2:190313384-190313406 AAGGACAACCCAAATGCGTAAGG + Intronic
943767306 2:191677336-191677358 GAAGAAAAGCTAAATGGGGAAGG + Intergenic
944493453 2:200282467-200282489 AAGGAGACTCCAATGGGGGATGG + Intergenic
944573860 2:201072132-201072154 AAGGAGAGACTAAATGGAGAAGG + Intronic
944622766 2:201533973-201533995 AAGTAGAAGCCCCATGGAGAAGG + Intronic
944826997 2:203494160-203494182 AAGGAAAAGCAAAGTGGGCAAGG - Intronic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946204386 2:218093030-218093052 AAGGAGCAGCCAAATGGATGAGG + Intergenic
946227378 2:218271221-218271243 AAGGAGAATCCAAAGGGAAATGG - Intronic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
947319508 2:228900569-228900591 AAGAAGAAGCCAAATGTGCAAGG + Intronic
947953196 2:234165393-234165415 GAGGGGAAGACAAGTGGGGATGG - Intergenic
948260756 2:236602817-236602839 AAGAAGAAGCCTCATGGGCATGG + Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948361308 2:237422393-237422415 AGGGAGAAGCCTTATGGAGATGG - Intronic
1168914052 20:1471999-1472021 AAGGAGAAAACAGAAGGGGAGGG + Intronic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1169689991 20:8319832-8319854 AAGGAGAAGCCTCTTGGGGTGGG + Intronic
1169798620 20:9492864-9492886 AAGAAGAAGACAAATGGTGCGGG + Intergenic
1169961794 20:11168285-11168307 AAAGGGAATCCAAGTGGGGATGG + Intergenic
1170036132 20:11992181-11992203 AAGGCCAAGGCAAATGGGGGAGG - Intergenic
1170075226 20:12411454-12411476 AAACAGAAGGCAAAGGGGGAGGG - Intergenic
1170102717 20:12720132-12720154 CAGGGGCAGGCAAATGGGGAGGG - Intergenic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1170950300 20:20930690-20930712 AAGTAGCAGGTAAATGGGGAAGG - Intergenic
1172030724 20:31980335-31980357 AAGGGGTAGGCAGATGGGGAGGG + Intronic
1173827889 20:46058814-46058836 CAGGAGCTGCCAGATGGGGACGG - Intronic
1175794593 20:61763724-61763746 GAGGTGAAGCCACATGGGGGAGG - Intronic
1177185212 21:17786128-17786150 AAGTGGATGCCAAATGGTGAAGG + Intergenic
1177733318 21:25057336-25057358 AAAGAGAAGCCAATTCAGGAAGG + Intergenic
1178150830 21:29791495-29791517 AAGGAGAAGGGAAGTGGGGGGGG + Intronic
1178637722 21:34319578-34319600 AAGGAGAATGGATATGGGGAAGG + Intergenic
1179976485 21:44871013-44871035 AACGAGCAGCCAAACGGGCATGG + Intronic
1180926639 22:19559662-19559684 TAGGAGAAGCCACATGGTGATGG - Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182415328 22:30217737-30217759 AAGGAGGAGGCCAGTGGGGAGGG - Intergenic
1182704806 22:32270445-32270467 AAAGAGAATCCCAAGGGGGAGGG + Intergenic
1183309348 22:37101092-37101114 AAGGAGCAGAGAAATGGGGGAGG + Intronic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1184328970 22:43813565-43813587 ATAAAGAAGGCAAATGGGGAGGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949946569 3:9194242-9194264 AAGCACAAGCCAAGTGGGGCTGG + Intronic
950630968 3:14281747-14281769 AAGCAGGAGCAAATTGGGGAGGG - Intergenic
951597838 3:24336984-24337006 AAGGAAAAGACACATGGGAAAGG + Intronic
951844782 3:27073506-27073528 AAGGAGAAGGCAGGTGGGGGAGG + Intergenic
952972683 3:38662608-38662630 AAGGAGATGGCAAATGGGAGTGG + Intergenic
953841698 3:46394848-46394870 AAGGAGAGGACAGGTGGGGATGG + Intergenic
954136957 3:48586307-48586329 AAGGAGTAGGCTGATGGGGAAGG - Intronic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
955073532 3:55591761-55591783 AAGGACAAGAATAATGGGGATGG - Intronic
956392732 3:68790936-68790958 AAGGATAAGGCAAACGTGGATGG + Intronic
957119273 3:76068751-76068773 AAGGAGAAGGCAGATTGGGGTGG - Intronic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
958039714 3:88212128-88212150 AAGAAGAAGTCAAATCTGGAAGG - Intergenic
959376727 3:105596742-105596764 AAACAGAAACCAAATGGGAAGGG - Intergenic
961137867 3:124528564-124528586 AAGTTGAAGCCAAATGGGAGGGG + Intronic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
963614361 3:147517133-147517155 AACAAGAAAACAAATGGGGAAGG - Intergenic
963754973 3:149225522-149225544 AATGGGCAGCCAAAGGGGGATGG - Intergenic
963933097 3:151024639-151024661 AAGCCCAAGCCACATGGGGAGGG - Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965903092 3:173668444-173668466 AAGTAGAAGCCATATCTGGAAGG + Intronic
966724852 3:183099822-183099844 GGGAAGAAGCCAAATGCGGATGG + Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966861601 3:184233676-184233698 AAGGAGAAGGTATATGGGGCAGG - Exonic
967129424 3:186457064-186457086 ATGGAGAAGCCACATGGAGAGGG + Intergenic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
969144455 4:5109255-5109277 AAGGGGAAGGCAAATGGCCAGGG + Intronic
969288077 4:6220610-6220632 AAGGAGAAGCCAATCCGGGCTGG - Intergenic
970385512 4:15552498-15552520 AAGGAGAAACAAATTAGGGAAGG - Intronic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
971397207 4:26239713-26239735 AAGGAGAAGAGAAGAGGGGAGGG + Intronic
971415624 4:26425694-26425716 AAGGAGAGGGAAAATTGGGAGGG - Intronic
973888117 4:55343200-55343222 AAGGACAACCCAAATGCGTAAGG + Intergenic
974574957 4:63706743-63706765 AAAGAGAATCAAAATGGGAAAGG + Intergenic
974753777 4:66176796-66176818 AAGGAGAAGGGAAAGGGAGAGGG + Intergenic
975108118 4:70592185-70592207 AAAGTGAAGCAAAATGGCGAGGG - Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
975501783 4:75094559-75094581 AAGGACATCCCAAATGGGAAAGG - Intergenic
975749129 4:77504997-77505019 AAGGAGAAGGCCAGAGGGGAAGG + Intergenic
976478806 4:85514951-85514973 ATGCAGAAGCCAGATAGGGAAGG + Intronic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
976779563 4:88743938-88743960 AAGGAGAAGACAAAATGGGATGG + Intronic
977145048 4:93429203-93429225 ATGGAGAAGCCAGATGGCAAAGG + Intronic
977851269 4:101832819-101832841 AAGGAGAAAACCAATGGAGATGG - Intronic
978187203 4:105870373-105870395 AAGGAGTAACCTAATGGAGACGG + Intronic
978802412 4:112767989-112768011 AAGGAGAAAACAAAGGGAGAAGG + Intergenic
978862736 4:113470290-113470312 AAGTAGGAGCAAAATGGGGGGGG - Intronic
979016747 4:115444045-115444067 AAGGACAACCCAAATGCGTAAGG - Intergenic
979318799 4:119299542-119299564 AAGCAGACACCAAATGGAGATGG - Intronic
979492089 4:121339712-121339734 AAGGAGAGGCCAAGGGGGAATGG + Intronic
979811156 4:125037959-125037981 AAGGAGAGGCCACATGGAGTTGG + Intergenic
980175055 4:129334462-129334484 AAGCAGAGGCCAAAAGAGGATGG + Intergenic
981996472 4:150980662-150980684 AAGGGGAATCCAAATTGGAAAGG + Intronic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983237864 4:165200175-165200197 AAGAAGCAGCCAAATGGCAATGG - Intronic
984188535 4:176576567-176576589 AATGAGAAGCCAACAGGGAAGGG + Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985136132 4:186787915-186787937 AAGGACAAGCCAAAGGCGGATGG - Intergenic
985210551 4:187588109-187588131 AAGGGGAAGGCATATGGGTAGGG + Intergenic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988458549 5:31411048-31411070 AAGGAGAAGGTAAATGGGCATGG - Intronic
990579910 5:57157958-57157980 AAGGATAAGCCATATGCGTAAGG - Intergenic
990980876 5:61601603-61601625 CATGAGAAGCCAGGTGGGGAGGG - Intergenic
991499785 5:67265783-67265805 AAGGAAAAGCCAGATGGAAAGGG - Intergenic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
992007375 5:72491096-72491118 AAGGAGAAACTATATGGGGTAGG + Intronic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
992825692 5:80547890-80547912 AAGGTGACACCAAAAGGGGATGG + Intergenic
993054613 5:82968000-82968022 AAGGAGACACCAAATGGGAGTGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994501849 5:100589093-100589115 AAGGAGGTACCAAATGGGAAAGG - Intergenic
994825802 5:104711404-104711426 AAGGGAATGCCAAATGGGTAAGG + Intergenic
996366334 5:122705187-122705209 AAGAAGAAAACAAAGGGGGATGG - Intergenic
996644731 5:125799821-125799843 AAGGAGGAGCCAAATGGAAGAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997528996 5:134570737-134570759 AAGGAGCAGCCAGAGAGGGAGGG - Intronic
998042597 5:138961898-138961920 TTGGAGAAGCTAAAAGGGGAAGG - Intronic
998228587 5:140345270-140345292 GAGGAGACTCCAAATGGGGAGGG - Intronic
999393138 5:151208826-151208848 AAGCAGAAGCCAGAGTGGGAAGG - Intronic
999435422 5:151559684-151559706 AAAGAAAAACCAAATGGGGTTGG - Intronic
1001115809 5:168938594-168938616 AAGGATAAGGCAGAAGGGGAAGG - Intronic
1003175631 6:3751039-3751061 GCGGAGGAGCCAAATGGGGCGGG - Intronic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1005184095 6:23144080-23144102 AAAGCTAAGCCAAATGGGAAAGG - Intergenic
1005377582 6:25199726-25199748 AAGGAGAAGGCACATGAGCAAGG - Intergenic
1005843591 6:29760608-29760630 AAGCACAAGCCAGATGGTGAAGG + Intergenic
1006192006 6:32215188-32215210 AAGGAGGGGGCAGATGGGGAGGG + Intronic
1006257522 6:32843686-32843708 AAGAAGAGGCCACATGGGGATGG - Intronic
1006317509 6:33299037-33299059 GAGCAGGAGCCAAAAGGGGAAGG + Exonic
1007389376 6:41541457-41541479 AAGGAGAGGCACAGTGGGGAGGG + Intergenic
1008482684 6:52002689-52002711 AAGGAGAAGACAAGGAGGGAAGG + Intronic
1008595737 6:53039944-53039966 AAGGTGAGGCATAATGGGGAGGG + Intronic
1009377979 6:62994808-62994830 AAAGAGAAGCCAAATGTTCATGG - Intergenic
1009436590 6:63625852-63625874 AAGAAGAAACCAAATTGGGCCGG + Intergenic
1009564431 6:65294014-65294036 AAGGAGAAATCAAATGGAAAGGG + Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010182312 6:73101429-73101451 AAAGAGCATCCAAATTGGGAAGG + Intronic
1010434249 6:75811791-75811813 AAGGAAAAGAGAAAGGGGGAGGG + Intronic
1011150966 6:84273018-84273040 AAAGATAAGTGAAATGGGGAAGG + Intergenic
1011736981 6:90320856-90320878 AAGAAGAAGTCAGATAGGGAAGG - Intergenic
1012449048 6:99335611-99335633 AAGGACAACCCAAATGCGTAAGG + Intronic
1012943486 6:105441770-105441792 AAGGAGATGGCAAATGGACATGG + Intergenic
1014045354 6:116877693-116877715 AAGGAGTAGCCTACTGGGGTGGG - Intronic
1014573157 6:123036619-123036641 AAGGTGAAGGGAAAAGGGGATGG - Intronic
1014742785 6:125166156-125166178 AAGAAAAAGCCAATTTGGGATGG + Intronic
1016756780 6:147696211-147696233 AAGGAGAAGGCAAGTTTGGAGGG - Intronic
1017367486 6:153661213-153661235 AAGAAAAATCCAAATGGAGAAGG - Intergenic
1017628410 6:156371425-156371447 TAGGAGAAGCCAAGCGGGGAAGG - Intergenic
1018140538 6:160829662-160829684 AAGGAAAAATCAAATGGAGAGGG + Intergenic
1018161293 6:161045263-161045285 AAGGAAAAGCAAATTGGGAAAGG - Intronic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018511991 6:164534024-164534046 GAGGAGAAGCCAATTGGGAGGGG + Intergenic
1019131226 6:169877677-169877699 AACTAAAAGCCAGATGGGGAGGG - Intergenic
1020540089 7:9451531-9451553 AAGTTAAAGCCAAATGGGCAGGG - Intergenic
1020688041 7:11319915-11319937 AATGAGAAGCCAGATGGAAAGGG - Intergenic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022212359 7:28224140-28224162 AAGGAGAAAAGAAATGGGGTCGG - Intergenic
1022290835 7:29000987-29001009 AAGGAGAAGGCTAATTTGGAAGG + Intronic
1022537851 7:31108991-31109013 AAGGAGCAGCCCCCTGGGGATGG + Exonic
1022850562 7:34257324-34257346 AAAGAGAAGCCACAGGGGGTGGG - Intergenic
1023369931 7:39503030-39503052 AAGGAGTAGGCACATGGAGAAGG - Intergenic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1024412432 7:49060592-49060614 AAGGAGATGCCAAATCGGAGTGG - Intergenic
1025021107 7:55480986-55481008 AATGAAAAGCCAACAGGGGAGGG + Intronic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1026031930 7:66801785-66801807 CAGGTGGAGCCAAATGGGAAAGG - Intronic
1026141654 7:67712004-67712026 AGGGTGAGGCCAGATGGGGAAGG + Intergenic
1027764174 7:82318818-82318840 AATGAGAAGACAAATAGGAAAGG + Intronic
1028002522 7:85517423-85517445 AATGACAAGCCAGATAGGGATGG - Intergenic
1028046847 7:86130868-86130890 AAGGGGAAGTAAAAAGGGGACGG + Intergenic
1028308025 7:89290649-89290671 AAGGAGAGGTAAAAGGGGGAAGG + Intronic
1028502914 7:91538867-91538889 AAAGCCAAGGCAAATGGGGATGG - Intergenic
1029435453 7:100561756-100561778 AAGCAGCGGCTAAATGGGGAAGG + Intronic
1031179328 7:118394502-118394524 CGGGAGAAGCCAGAAGGGGATGG + Intergenic
1031955133 7:127935246-127935268 AAGTAAAAGCCAAAGGGTGAAGG + Intronic
1033215093 7:139487651-139487673 AAGGGGAAGACAAAGGGGAAGGG + Intergenic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033834786 7:145296784-145296806 AAGGTCAAGGCACATGGGGATGG - Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1036008328 8:4692534-4692556 AAGGAGCAGCCACATGAAGAGGG + Intronic
1036776582 8:11617129-11617151 AAGGACAGGGCACATGGGGAAGG + Intergenic
1037780051 8:21861698-21861720 TAGGAGAAGCCATGTGGGCAGGG + Intergenic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040913719 8:52546733-52546755 AAGGACAAACCAAATGCGTAAGG + Intronic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041465313 8:58152565-58152587 AAGGAAAAGCCAGAAGGAGATGG + Intronic
1042319084 8:67456307-67456329 AAAGAGAAGCCAATTTGAGAGGG - Intronic
1042591067 8:70399771-70399793 AAGGAAAATACAAAAGGGGATGG - Intronic
1043964065 8:86451801-86451823 AAGGAGATTCCAAAAGGAGATGG - Intronic
1045345772 8:101292246-101292268 GTGGAGAGGCCACATGGGGAGGG - Intergenic
1045503230 8:102759047-102759069 GAGGGGAGGCCAAAGGGGGAGGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045842656 8:106597801-106597823 AAGCAGAAGCCAGATCGTGAAGG - Intronic
1046218327 8:111179571-111179593 GAGGAGTAGCCAAATGAGGCTGG + Intergenic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046774943 8:118153958-118153980 AAAGAGGATCTAAATGGGGAAGG - Intergenic
1046793460 8:118345979-118346001 CAGGACAAGCCAAATGGAGACGG - Intronic
1047830143 8:128620669-128620691 AAGATAAAGCCAAATGGGTAAGG - Intergenic
1047958891 8:129996506-129996528 AAACAGAAGCCAAGTGGGAAAGG + Intronic
1048215036 8:132486415-132486437 GAGCAGAGGCCACATGGGGAAGG + Intergenic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049304465 8:141893576-141893598 ATAGAGAAGCCAGATGGTGAGGG - Intergenic
1050000577 9:1073104-1073126 AAAGAGAAGCTATAAGGGGAAGG - Intergenic
1050301288 9:4261338-4261360 AAAGAGAAGAGAAATAGGGATGG + Intronic
1050938469 9:11427622-11427644 TGTGAGAAGCTAAATGGGGATGG + Intergenic
1051433234 9:17002141-17002163 TAGGTGAGGACAAATGGGGATGG + Intergenic
1053295255 9:36908254-36908276 AAAGAGAAGCCAAGAGTGGATGG + Intronic
1053335343 9:37265205-37265227 AAGGAGAAGGCAAATGTAAAAGG - Intronic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1056550173 9:87646277-87646299 GATGAGAATCCAAAAGGGGAAGG + Intronic
1057261332 9:93586474-93586496 CAGGAGAAGCCAGCTGGGGGAGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058817559 9:108699030-108699052 AAGGGGAAGGCAAAGGGGAAGGG + Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1060125630 9:121041900-121041922 AAGGAAAAGCCTAAAGGGGGTGG - Intronic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1185612954 X:1402976-1402998 AAGGAGACGGCATTTGGGGAGGG - Intergenic
1185978548 X:4749396-4749418 AAGGAAAAGGCAAAATGGGAGGG - Intergenic
1186114622 X:6292503-6292525 CAGGAGAAGCCAAAAGCTGAGGG - Intergenic
1186164115 X:6808564-6808586 AAGGAGAAGGGAAATGGAAAGGG - Intergenic
1187587102 X:20675390-20675412 AAGCAGAATCCAAATGGCAAGGG + Intergenic
1188242033 X:27804616-27804638 ATGGAGAAGCCAAACGGGAGAGG - Intergenic
1188353982 X:29167281-29167303 AAGGGGAAGCGGAATGGGAAGGG - Intronic
1188754835 X:33949693-33949715 AAAGGGAATCCAAATTGGGAAGG + Intergenic
1188840726 X:35013892-35013914 AAGGACAACCCAAATGCGTAAGG + Intergenic
1188985060 X:36761746-36761768 AAGGAGCAGCCAAACATGGAAGG - Intergenic
1189091580 X:38089000-38089022 CAGGAAAGGCCTAATGGGGAAGG + Intronic
1190114531 X:47617950-47617972 AAGGAAAAGTCCTATGGGGAGGG + Intronic
1190328348 X:49220459-49220481 AAGGAGCAGGCAAGTGGGCAGGG - Exonic
1190801982 X:53797789-53797811 AAGGAGAAGGGATTTGGGGATGG + Intergenic
1190922573 X:54869813-54869835 AAGGAGAAGAGAAAAAGGGAGGG - Intergenic
1191881697 X:65849030-65849052 ATGGACAAGGCAAGTGGGGATGG - Intergenic
1192323431 X:70111556-70111578 AAGGACAACCCAAATGTGTAAGG + Intergenic
1192725530 X:73747563-73747585 AATGAGAATCCAAATTGGAATGG - Intergenic
1193213524 X:78836376-78836398 AAGGAGGAGCCAAATTATGAAGG + Intergenic
1194054146 X:89110078-89110100 ATGGAGGAGCCAAAGGGAGATGG + Intergenic
1194599925 X:95907643-95907665 AAGAAGTATCCAAATGGGAATGG + Intergenic
1195957568 X:110348845-110348867 AAGGGGAAGTAAAATGGGCAGGG + Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1199157398 X:144566825-144566847 AAGCAGAAGGCCTATGGGGAGGG - Intergenic
1199282590 X:146019989-146020011 AAGGACAACCCAAATGTGTAAGG + Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1200357018 X:155562492-155562514 AAAGAGAAGCCAAATGTTAATGG - Intronic
1202101136 Y:21309236-21309258 AAGGAGAAGAAAAAAGGGAAAGG + Intergenic