ID: 1057730130

View in Genome Browser
Species Human (GRCh38)
Location 9:97601324-97601346
Sequence GGCAGCCACCATGGCAGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057730122_1057730130 22 Left 1057730122 9:97601279-97601301 CCTGTGTGACAGGGACATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 180
Right 1057730130 9:97601324-97601346 GGCAGCCACCATGGCAGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 305
1057730125_1057730130 1 Left 1057730125 9:97601300-97601322 CCTGGCACACTGGCCAGAAGACT 0: 1
1: 0
2: 1
3: 10
4: 202
Right 1057730130 9:97601324-97601346 GGCAGCCACCATGGCAGTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057730130 Original CRISPR GGCAGCCACCATGGCAGTGC TGG Exonic
900265243 1:1753953-1753975 TGGAGCCAGCATGGCAGAGCGGG + Intronic
902330186 1:15727507-15727529 GGCGGCCACCATGACCCTGCAGG + Exonic
903718103 1:25384342-25384364 TGCACCCACCATCACAGTGCAGG - Intronic
904477231 1:30773163-30773185 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477238 1:30773200-30773222 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477245 1:30773237-30773259 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477252 1:30773274-30773296 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477259 1:30773311-30773333 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477266 1:30773348-30773370 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477273 1:30773385-30773407 GAGAGCCACCACGTCAGTGCCGG - Intergenic
904477280 1:30773422-30773444 GAAAGCCACCACGTCAGTGCCGG - Intergenic
904576094 1:31505913-31505935 GGCAGCCCACGTGGCAGTGCTGG + Intergenic
904972879 1:34432814-34432836 GGAAGTCACCATGGGAGTTCAGG - Intergenic
905811620 1:40917336-40917358 GGCAGGGCCCATGGGAGTGCTGG - Intergenic
907581733 1:55578325-55578347 AGCACCCACCTTGGAAGTGCTGG + Intergenic
907908227 1:58804513-58804535 GACAGCCAATATGGGAGTGCTGG - Intergenic
909903361 1:81165974-81165996 GGCAACAAACATGGGAGTGCAGG - Intergenic
911057444 1:93720883-93720905 GGCAGACACCATGAGAGCGCAGG - Intronic
911183713 1:94883169-94883191 GGCAGGCATGGTGGCAGTGCTGG + Intronic
911194099 1:94976408-94976430 GTCAGCCACCATGCCCGTTCTGG - Exonic
911287427 1:96013262-96013284 GGCAGCAGCCATGGCAGGGAGGG - Intergenic
911408656 1:97473429-97473451 TGCAGTCAACATGGGAGTGCAGG + Intronic
913166193 1:116188093-116188115 TGCAGCAAGCATGGAAGTGCAGG + Intergenic
913965844 1:143377050-143377072 GGCCGCCACCATTGCCGTGGTGG + Intergenic
914060218 1:144202658-144202680 GGCCGCCACCATTGCCGTGGTGG + Intergenic
914118932 1:144763711-144763733 GGCCGCCACCATTGCCGTGGTGG - Intergenic
915207660 1:154282655-154282677 TGCAGTGAACATGGCAGTGCAGG - Intergenic
917479216 1:175396545-175396567 GGTGGCCACCTTGGCAGTGATGG + Exonic
918142772 1:181732722-181732744 GGGAGCCACCATGGCTGGCCAGG + Exonic
918216849 1:182399346-182399368 GCCTGCCACCATGCCCGTGCTGG - Exonic
921285365 1:213604651-213604673 GGCAGCCCACATGGCAGGTCTGG - Intergenic
922551591 1:226498179-226498201 GGCAGCTACAATGCCAGTGTTGG - Intergenic
923098492 1:230793994-230794016 GGCAGCCAGCACTGCCGTGCAGG + Intronic
924568190 1:245215211-245215233 GGCAGCCACCATGGGAGGAAGGG + Intronic
1062876195 10:944673-944695 GGCAGACACCAAGGCAGGGCGGG - Intergenic
1063709067 10:8459422-8459444 GACATGCACCATGTCAGTGCTGG + Intergenic
1064408946 10:15088716-15088738 AGCCGCCACCATGGCCCTGCAGG - Exonic
1068613711 10:59088849-59088871 GGCAGCCTCCTTTGCAATGCAGG - Intergenic
1069862146 10:71478448-71478470 GGAAGGGGCCATGGCAGTGCAGG - Intronic
1069922589 10:71825604-71825626 GGAAGCCACCAGGGCAGTCCTGG + Intronic
1070731418 10:78831219-78831241 AACAGCCACGATGGCCGTGCAGG + Intergenic
1070785755 10:79161268-79161290 GGAAGCCCCCATGGCTGTGAAGG - Intronic
1071263850 10:83946135-83946157 GCCAGCTGCCATGGCTGTGCTGG - Intergenic
1071464220 10:85924946-85924968 GGCAGCTTCCAGGGCTGTGCAGG + Intronic
1073322105 10:102621636-102621658 GGCACCCACGATGGCAGTGGAGG - Intronic
1075403456 10:122177788-122177810 AGCAGGGACCATGGCAGTTCTGG - Intronic
1075477966 10:122752985-122753007 GGAAGGCACCAGGCCAGTGCTGG - Intergenic
1076020964 10:127072766-127072788 AACAACCACCATGGCAGTGCTGG - Intronic
1077501838 11:2912878-2912900 GGCAGCCACCAGGGCCATGCCGG + Intronic
1081683742 11:45027032-45027054 GGCGGCCACCCTGGCAGCGAGGG - Intergenic
1082010578 11:47447528-47447550 CACAGCAAACATGGCAGTGCAGG + Intronic
1084274563 11:68044788-68044810 GGCCCCCACCAGGGCAGAGCAGG + Intronic
1084442440 11:69182439-69182461 GTTAGACACCATGGAAGTGCTGG - Intergenic
1084695112 11:70748412-70748434 GGCACCCACCATGGTTGTGGGGG - Intronic
1085173930 11:74470611-74470633 GGCAGCAACCATGTCAGGGAAGG + Intergenic
1089163538 11:116457787-116457809 AGCAGCCCTCATGGCACTGCAGG - Intergenic
1089528598 11:119112588-119112610 AGCAGCCACCATGGCAGTGGAGG + Exonic
1090066957 11:123511338-123511360 GGATGCCCCAATGGCAGTGCGGG + Intergenic
1090116195 11:123977026-123977048 TGCAGCCACGATGCCAATGCTGG + Exonic
1090802122 11:130179518-130179540 ACCTGCCACCATGGCAGTCCAGG - Intronic
1091058461 11:132440418-132440440 GGCTGCCTCCATGGCTGGGCCGG + Intronic
1091059110 11:132445104-132445126 GGCAGCCAGCATGGCCGCCCTGG - Intronic
1091568628 12:1665143-1665165 TGGAGGCACCATGGCAGGGCTGG - Intergenic
1091947832 12:4564405-4564427 GGCAGAAAGTATGGCAGTGCAGG - Intronic
1092112850 12:5976171-5976193 GGCATCCTCCATGTCGGTGCAGG + Exonic
1092238014 12:6821862-6821884 TGCGGTCTCCATGGCAGTGCTGG + Exonic
1092295023 12:7190368-7190390 GGCGGTCACCATGGCAATGCGGG + Exonic
1094471550 12:30806215-30806237 GGCTCCCACAATGGCTGTGCTGG - Intergenic
1096890246 12:54762647-54762669 GGCAGCACCCATGGCCATGCAGG + Intergenic
1096967117 12:55637313-55637335 GGTACCCACCATGGCCATGCAGG - Exonic
1100723839 12:97387480-97387502 GGCACCCCCCAAGGAAGTGCTGG + Intergenic
1101756210 12:107622396-107622418 GGCAGCCATCATCACAGAGCTGG + Intronic
1102146959 12:110661419-110661441 GGGAGCCACCTTGGCCCTGCGGG + Exonic
1102445321 12:112997869-112997891 GGCAGCCACCATGGGTGGGGAGG + Intronic
1105892158 13:24689558-24689580 GGCACCACCCAGGGCAGTGCTGG + Intronic
1110744440 13:79036408-79036430 GGCAGGGACTATGGCAGTGCAGG + Intergenic
1112475863 13:99730380-99730402 TCCAGCCACCTGGGCAGTGCTGG - Intronic
1112591567 13:100768030-100768052 AGCAGACAAAATGGCAGTGCAGG + Intergenic
1113612423 13:111656710-111656732 GGCAGCCACCGTGGCCGCCCAGG + Intronic
1113646053 13:111996796-111996818 AGCAGCCACCAAGGCAGCCCCGG + Intergenic
1114744610 14:25134322-25134344 GGTGGCCACAATGGCAGTGGCGG - Intergenic
1114812582 14:25917680-25917702 GGAAGCCCCCATGGCTTTGCAGG - Intergenic
1115006519 14:28492116-28492138 GCCTGCCACCATGGCTCTGCTGG + Intergenic
1115577523 14:34725595-34725617 TGCAGCCACCATGCGAGTCCTGG + Intergenic
1115847657 14:37555704-37555726 GGCAGCCACCCTGTCAGGGAGGG - Intergenic
1116515960 14:45805797-45805819 GACAGCCACCATGTCAGGGAGGG - Intergenic
1117656910 14:57964752-57964774 CACAGGCACCATGGCAGTGAAGG + Intronic
1117750468 14:58917366-58917388 GGCAGCAACCATGGAAATGAAGG - Intergenic
1118129208 14:62943752-62943774 GGCTGCCACCAGAGCAGTGGAGG + Intronic
1119500927 14:75126909-75126931 GGCCGCCGCCATGTCGGTGCTGG - Exonic
1121662499 14:95645990-95646012 GGCAGCCACCTTCCCAGTTCTGG + Intergenic
1121786849 14:96668354-96668376 GGCAGCAACCCTGGAGGTGCAGG + Intergenic
1122401073 14:101467786-101467808 GCCAACATCCATGGCAGTGCTGG + Intergenic
1122450339 14:101800761-101800783 TGCAACAAACATGGCAGTGCAGG - Intronic
1123109752 14:105860528-105860550 GGAAGCCAGCCTGGCTGTGCAGG - Intergenic
1123451814 15:20371431-20371453 GACAGCTACCTTGGCAATGCAGG + Intergenic
1123938982 15:25207645-25207667 GGCAGCCAGCAGGGCAGTGGAGG + Intergenic
1124211408 15:27767973-27767995 AGCAGCCACAATGGCAGTGGAGG + Intronic
1125754886 15:42056947-42056969 AGCTGCCACCCTGGCAGGGCCGG + Intergenic
1129198245 15:73983632-73983654 GGAAGCCAGCAGGGCAGGGCAGG + Exonic
1129666584 15:77582710-77582732 GGCAGTGACAATGGCTGTGCTGG + Intergenic
1129688342 15:77698911-77698933 GGCACCCACTAGGGCAGTCCAGG - Intronic
1130548156 15:84871424-84871446 GGCAGCCACCAGGCCACTTCAGG - Exonic
1131734482 15:95317515-95317537 GGGAGCCACCATAGCAGCTCTGG - Intergenic
1132292573 15:100713775-100713797 GGCAGGCACCTGGGCAGGGCCGG - Intergenic
1133410532 16:5564814-5564836 GGCATCCACCAGAGAAGTGCTGG - Intergenic
1133925673 16:10190198-10190220 GGCTGCCTCCTTGGCAGAGCAGG - Intergenic
1134521872 16:14922521-14922543 GGTGGCCACCAGGGCAGGGCAGG - Intronic
1134709542 16:16321172-16321194 GGTGGCCACCAGGGCAGGGCAGG - Intergenic
1134716755 16:16361201-16361223 GGTGGCCACCAGGGCAGGGCAGG - Intergenic
1134950061 16:18347473-18347495 GGTGGCCACCAGGGCAGGGCAGG + Intergenic
1134957997 16:18390958-18390980 GGTGGCCACCAGGGCAGGGCAGG + Intergenic
1135382945 16:22008844-22008866 GGCAGCCTGCGGGGCAGTGCGGG + Intronic
1135698036 16:24607416-24607438 CGCCACCACCATGGCACTGCAGG - Intergenic
1136281926 16:29218346-29218368 GGCACCCAGCCTGGCAGTGTGGG + Intergenic
1137903583 16:52295860-52295882 GTCAGCCACCATGGGTGGGCTGG + Intergenic
1138502917 16:57459578-57459600 GGCAGCCAGCATGGCTCGGCGGG - Exonic
1138559066 16:57789175-57789197 CGCAGCCTCCTTGGCAGTCCTGG - Intronic
1139509492 16:67418813-67418835 GCCTGCCACCATGGGATTGCAGG + Intergenic
1139700648 16:68706088-68706110 TGCAGCCCCCATGTTAGTGCTGG - Intronic
1141486693 16:84344936-84344958 GGCAGCCCTCCTGGCTGTGCCGG + Intergenic
1141886445 16:86895576-86895598 GGCAGCCACCATGGCCTCCCTGG + Intergenic
1141914138 16:87082403-87082425 AGCAGCCACCATATCAGAGCAGG - Intergenic
1141919353 16:87125753-87125775 GGCAGCCAGCAGGGCACGGCCGG - Intronic
1142086302 16:88184262-88184284 GGCACCCAGCCTGGCAGTGTGGG + Intergenic
1142389456 16:89789324-89789346 CGCAGCCACGATGGCGATGCAGG + Intronic
1143108489 17:4541074-4541096 GGCAGCCATCAGGGCAGGGCTGG - Intronic
1143898497 17:10155705-10155727 GGCAGCCTTCATGACAGTGTCGG + Intronic
1144828318 17:18118791-18118813 GGCAGCCACCATGGCGAAGGAGG + Exonic
1145229980 17:21166442-21166464 GGCAGCTACCTTGCCAGTGGCGG - Intronic
1146275202 17:31512000-31512022 GCCAGCCACTCTGGCAGGGCAGG - Intronic
1148443181 17:47722224-47722246 AGCAGCCACTGTGGCAGTGGAGG - Intergenic
1149638775 17:58190278-58190300 ATCAGCCACCATGGCAGGGCTGG + Intergenic
1150250629 17:63702399-63702421 GCCAGCCAGCATGGCAGGGATGG + Intergenic
1151697423 17:75724641-75724663 GGCACCGACCATGGCTGTGGAGG + Intronic
1151882195 17:76902657-76902679 GGCACCCACCCTTGCTGTGCAGG - Exonic
1151920174 17:77148662-77148684 CGCTGCAACGATGGCAGTGCTGG - Intronic
1151947878 17:77329399-77329421 GGCAGCCACCAGGGCAGCACAGG - Intronic
1152147161 17:78575268-78575290 GGCACCCCCCATGGCGGGGCCGG - Intronic
1152584098 17:81181471-81181493 GGCAGCCCCCATCCCAGGGCGGG + Intergenic
1152754262 17:82080586-82080608 CGCAGCTGCAATGGCAGTGCCGG + Exonic
1153040883 18:812231-812253 GGCAGCAACGACGGCAGAGCCGG + Intronic
1153477114 18:5509212-5509234 GCCAGCCCCCATGGCAGAGGAGG + Intronic
1153762533 18:8346086-8346108 GGGAGCCAGCATGGGAGTGCAGG + Intronic
1156463797 18:37336190-37336212 GGCAGCCACCACAGCCGTGAGGG - Intronic
1156501928 18:37565550-37565572 GGCAGCAGCCCGGGCAGTGCCGG - Exonic
1158259325 18:55589908-55589930 GGCGGCCAAGATGGCGGTGCTGG + Intronic
1160033186 18:75279636-75279658 GACAGCCTCTCTGGCAGTGCGGG + Intronic
1160276099 18:77437937-77437959 GGCAGCCCTCATGGCAGTCCTGG + Intergenic
1160497378 18:79383416-79383438 GCCAGCCTCCCTGGCTGTGCGGG + Intergenic
1160502935 18:79411198-79411220 GGCGGCCACGATGGCCGAGCTGG - Exonic
1160531670 18:79568744-79568766 CGCAGCCACCTTGGAAGCGCTGG + Intergenic
1161167716 19:2797179-2797201 GGCAGCCCCCATGCCAGGGCTGG - Intronic
1161458038 19:4379762-4379784 AGCAGCCATCCTGGCAGTGAGGG - Intronic
1162042784 19:7980517-7980539 GGAAGCCACTATGGCCCTGCTGG + Intronic
1162464000 19:10830054-10830076 GGCAGCCACAGTGGCATGGCGGG + Intronic
1162550700 19:11356890-11356912 GGCAGCCAGCAGGGCAGGGATGG - Exonic
1162719599 19:12654418-12654440 GGCAGCCAGTGTGGAAGTGCAGG - Intronic
1162820712 19:13221795-13221817 GGCAGAGACCAGGGCAGTGTGGG - Intronic
1163723108 19:18907536-18907558 GGCAGCTGCCCTGGCAGTGGGGG - Intronic
1164418580 19:28067273-28067295 GGGAGCCACCATGGCCCTGGGGG - Intergenic
1164861515 19:31565642-31565664 GGCAGCTTCCATGGCAGAGGTGG - Intergenic
1164986113 19:32649927-32649949 GGCAGCCACTGTGGCCGTGTTGG - Intronic
1165099926 19:33432980-33433002 TGCAGGCAGCATGGCAGTGAGGG - Intronic
1166210475 19:41303722-41303744 GGCAGAGACCAAGGCAGTCCTGG - Intronic
1166432956 19:42741950-42741972 GGCATCTCCCAGGGCAGTGCTGG - Intronic
1166714067 19:44955424-44955446 GGCCGCCACCACGGCGCTGCGGG - Exonic
1166877400 19:45905784-45905806 TGCTGCCTCCATGGCAGTCCAGG + Intergenic
1167419516 19:49394833-49394855 GGCAGCCACCATGGTGGCGTGGG + Intronic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1202699622 1_KI270712v1_random:154543-154565 GGCCGCCACCATTGCCGTGGTGG + Intergenic
925634445 2:5929161-5929183 GGACACCACCATGGCTGTGCTGG - Intergenic
927503181 2:23595822-23595844 AGCAGCCACCCTGGGAGAGCTGG - Intronic
927797309 2:26061485-26061507 GGCAGCCAACACGGCTGTGGTGG - Intronic
928647143 2:33366621-33366643 TGCAGCTGCTATGGCAGTGCTGG - Intronic
930025992 2:47029453-47029475 GGCTGACACCATGGCAGGGCAGG - Intronic
931560393 2:63555109-63555131 GGCAGCCATCATTGCAGCTCTGG + Intronic
934170567 2:89538031-89538053 GGCTGCCACCATTGCCGTGGTGG + Intergenic
934280869 2:91612351-91612373 GGCTGCCACCATTGCCGTGGTGG + Intergenic
934529263 2:95075039-95075061 GGCAGCCAGGATGGCTCTGCTGG + Intergenic
936152869 2:110031189-110031211 GAGAGCCACCCTGGCAGTGGAGG - Intergenic
936191811 2:110340223-110340245 GAGAGCCACCCTGGCAGTGGAGG + Intergenic
936399905 2:112156956-112156978 GGAAGCCACCCTGGCTGTGGGGG + Intronic
937391671 2:121494140-121494162 TGCAGTAAACATGGCAGTGCAGG - Intronic
937432357 2:121849629-121849651 GGCAGCCAGCATGACACTTCTGG + Intergenic
940180365 2:150924980-150925002 GGGAGCCACCATTTCAGTGCCGG - Intergenic
942249396 2:174034559-174034581 GGCTGCCACAATGGCACTGGAGG + Intergenic
942365992 2:175228364-175228386 GGCAGCAATGATGACAGTGCAGG + Intergenic
942652613 2:178184222-178184244 ACCAGACAACATGGCAGTGCAGG - Intergenic
946200010 2:218065840-218065862 TGCAGCCAGCAGGGCATTGCAGG - Intronic
948291217 2:236826274-236826296 GGAAGCCACAATGTCAGTGGGGG + Intergenic
948318784 2:237052528-237052550 TGCTGCCACCATCTCAGTGCTGG + Intergenic
948325943 2:237120949-237120971 TGCATCCACCATGCCACTGCGGG - Intergenic
948852409 2:240714892-240714914 GGCAGTCTCCATGGCAGTGGAGG + Exonic
948860194 2:240749223-240749245 GGCAGCCAGGATAGCAGAGCCGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1168964518 20:1891225-1891247 AGCAGCCACGATGGCATGGCAGG - Intergenic
1169130501 20:3164265-3164287 GGCTGCCACGGGGGCAGTGCTGG + Exonic
1169570336 20:6899099-6899121 GGCTGCCACAAGGGCAGGGCCGG - Intergenic
1169745357 20:8937158-8937180 GACAGCCACCATGACAGTCAGGG + Intronic
1169824022 20:9746259-9746281 TGCCTCCATCATGGCAGTGCAGG + Intronic
1170906187 20:20516932-20516954 AGCAGACACAATTGCAGTGCTGG + Intronic
1171156298 20:22877836-22877858 GGCACCCACCATGGGAGTGCTGG + Intergenic
1172276059 20:33680035-33680057 GCCTGCCACTCTGGCAGTGCAGG + Intronic
1173376855 20:42493234-42493256 TGCAGCCAGAATGGCAGAGCTGG + Intronic
1174565880 20:51464135-51464157 GGCTGCCACCCTGTCACTGCAGG - Intronic
1175767175 20:61599576-61599598 GGCAGCCCCCAGATCAGTGCAGG + Intronic
1175810949 20:61856987-61857009 TGCAGCCACCATGGCCTTGGAGG + Intronic
1176059519 20:63166291-63166313 GGCCTCCACCAGGGCTGTGCGGG + Intergenic
1176092700 20:63326027-63326049 GGCTGTCACCATGGGAGGGCTGG + Intronic
1176216355 20:63949799-63949821 GGCAGCCGCAAGGGCGGTGCTGG - Intronic
1176259131 20:64169991-64170013 GGCAGCCTCCATGGCAGCCTGGG - Intronic
1177870196 21:26562982-26563004 GCCTGCTACCATGGCAGTGGTGG - Intronic
1179933092 21:44584385-44584407 TGCAGTTAGCATGGCAGTGCAGG + Intronic
1179941649 21:44642951-44642973 TGCAGTTAGCATGGCAGTGCAGG - Intronic
1180180344 21:46116095-46116117 GGGAGCCTGCCTGGCAGTGCTGG - Intronic
1181048013 22:20224677-20224699 GGCACACACCATGGCACGGCAGG + Intergenic
1181299190 22:21867428-21867450 GGCAGCCAACATGGCGGCGGCGG - Exonic
1181439948 22:22930630-22930652 GGCAGTCACCATGACATTCCTGG + Intergenic
1182972389 22:34590435-34590457 GACTGTCACCATGCCAGTGCAGG + Intergenic
1183184767 22:36285599-36285621 TGGAGCCACCACGGCAGAGCTGG - Intronic
1183288277 22:36981629-36981651 GGCTGCCCCCATGGCAGGGGAGG - Intergenic
1183513205 22:38247949-38247971 GCCAGGCACCATGACAGTGAGGG - Exonic
1184247127 22:43241427-43241449 TGCAGCCTCAATGGCAGAGCTGG + Intronic
1184985927 22:48134085-48134107 GCCAGGCACCAAGGCAGGGCTGG - Intergenic
949944619 3:9180180-9180202 GTCAGTCACCTCGGCAGTGCAGG + Intronic
950243291 3:11391521-11391543 GAGAACCAGCATGGCAGTGCTGG + Intronic
954714893 3:52522050-52522072 TGCAGCCACCATGCCCGTCCTGG - Exonic
955066442 3:55537209-55537231 GGCACCCAGCATGGCTGTGAGGG - Intronic
961359139 3:126356629-126356651 GGCAGCCGCTGTGGCTGTGCGGG + Intronic
961448624 3:126992494-126992516 GGCAACTACCATGGCAGAGATGG - Intronic
962715406 3:138121670-138121692 GGCAGACAAGGTGGCAGTGCAGG + Intergenic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
964177431 3:153840960-153840982 GGCAGCGACGGTGGCAGAGCTGG + Intergenic
967715325 3:192756008-192756030 TGCAGCAAACATGGGAGTGCAGG - Intronic
968863898 4:3195429-3195451 GGAGACCACGATGGCAGTGCAGG - Intronic
969029232 4:4197846-4197868 GGCCGCCACCATTGCTGTGGTGG - Exonic
969577384 4:8044296-8044318 GGCAGCCTACATGGCAGTCCCGG + Intronic
972286695 4:37656046-37656068 TGCAGACAACATGGGAGTGCAGG - Intronic
975016747 4:69430880-69430902 GGCAGCAGCCTGGGCAGTGCGGG - Intergenic
978710302 4:111772422-111772444 GGCAGGCACCATTACAGGGCTGG - Intergenic
979366871 4:119835992-119836014 GACAGCCACCATGTCGGTTCTGG - Intergenic
980901537 4:138909811-138909833 GGCAGCAGCAAGGGCAGTGCTGG - Intergenic
984885370 4:184445002-184445024 GGAAGCCACCATGGTACGGCAGG - Intronic
985152241 4:186959375-186959397 GGCAGGCACCATGCGAGTGCTGG + Intergenic
985152591 4:186961424-186961446 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985152747 4:186962303-186962325 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985153526 4:186966867-186966889 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985154144 4:186970436-186970458 GGCAGGCAACATGCGAGTGCTGG + Intergenic
985154466 4:186972310-186972332 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985541534 5:489751-489773 GGCCGCCCCCAGGGCAGTGATGG + Intronic
985573550 5:663428-663450 GGCAGCTTCCACGGCAGGGCTGG - Exonic
985693277 5:1325357-1325379 GGCAGCCACCAGCTCAGGGCAGG + Intronic
986257069 5:6109408-6109430 GGAACCCACCATGCCAGTGGTGG - Intergenic
986285930 5:6359006-6359028 GGCATACCCCATGGCACTGCTGG + Intergenic
991628636 5:68631572-68631594 GGCAGCCAGCATGGCAGGTCTGG - Intergenic
992181193 5:74200071-74200093 AGCATCCACCCTGACAGTGCTGG - Intergenic
997203251 5:132025684-132025706 GGCACCTGCCATGGCAGGGCAGG - Intergenic
997756380 5:136403407-136403429 GGAAGGCACCATGGAAGTGCTGG + Intergenic
997884111 5:137615429-137615451 GGCCCCCATCATGGCAGGGCTGG - Intergenic
999335262 5:150710639-150710661 GGCAGCCATTATGGCAATGAAGG + Intronic
1000329548 5:160196180-160196202 GGGAGCCACCATGGCACTCAAGG + Intronic
1001226367 5:169947781-169947803 AGCAGGCACCATGACAGTGAAGG - Intronic
1001820611 5:174707286-174707308 GGCAGCTACCGTGGCCCTGCTGG - Intergenic
1002099848 5:176851936-176851958 CACAGCGACCATGGCAGAGCCGG - Intronic
1002175069 5:177397013-177397035 GGCAGCCAGGATGGCCGTGGTGG - Exonic
1002365261 5:178704928-178704950 GGCAGTGACCATCGCTGTGCCGG + Intergenic
1002384863 5:178858968-178858990 TGCAGCTAACATGGGAGTGCAGG + Intergenic
1002611993 5:180426049-180426071 GTGAGCCACCATGCCAGTCCAGG + Intergenic
1003040902 6:2686543-2686565 GACATCCACCATTGCAGAGCAGG - Intronic
1003874410 6:10423423-10423445 GGCAGCCGCCCTGGCACAGCGGG - Intergenic
1005526166 6:26652114-26652136 GTGAGCCACCATGCCTGTGCTGG + Intronic
1005829775 6:29661254-29661276 GGGAGTGACCATTGCAGTGCTGG + Intronic
1007293779 6:40805973-40805995 GGGAGCCAGCATGTCAGAGCTGG - Intergenic
1007997263 6:46321628-46321650 GGAAGCCACCATTGCAGAGAAGG + Intronic
1011527541 6:88281722-88281744 GGCAGGCACCATGGCTTTGAAGG + Intergenic
1013465081 6:110410896-110410918 AGCAGCGACCTTGGCATTGCAGG - Intronic
1014149452 6:118036841-118036863 GTAAGCCACCATGGCAGGGCTGG + Intronic
1014741610 6:125153942-125153964 GTCAGCCACCATGGAGGCGCAGG + Exonic
1017053755 6:150419352-150419374 GGCCGTCACCATCGCAGTGGGGG - Intergenic
1018252152 6:161881921-161881943 GACAGGCACCATGGCAGAGTGGG + Intronic
1018801574 6:167226901-167226923 GGCAGCCACAAGGGCAATCCCGG - Intergenic
1018884246 6:167919547-167919569 GCAAGCCAGCTTGGCAGTGCTGG - Intronic
1018961934 6:168455415-168455437 GGCAGCCACCAAGCCCGGGCTGG + Intronic
1022579080 7:31530058-31530080 GGCAGCCACCTAGGTAGTCCTGG - Intronic
1023624352 7:42101316-42101338 GGGAGCCACCACGCCAGTCCTGG - Intronic
1023800096 7:43826611-43826633 GGTAGCCACACAGGCAGTGCTGG - Intergenic
1024354014 7:48396065-48396087 GGCTCCCACCAGGGCACTGCCGG + Intronic
1024549998 7:50554893-50554915 GGGAGGCAGCATGGCACTGCGGG + Intronic
1024992080 7:55242938-55242960 TGCAGTGACCATGGGAGTGCAGG + Intronic
1026458770 7:70595554-70595576 GGCAGCCCCAAGGGCAGGGCTGG + Intronic
1031131122 7:117834335-117834357 GTGAGCCACCATGCCAGGGCTGG + Intronic
1031578378 7:123442897-123442919 TGCAGTAAGCATGGCAGTGCTGG + Intergenic
1031627286 7:124005290-124005312 GGCAGCCATCTTTGCAGTCCAGG - Intergenic
1032389223 7:131544922-131544944 GTGAGCCACTATGACAGTGCTGG + Intronic
1032522579 7:132557091-132557113 GGCAGCCCCCATCCCACTGCTGG - Intronic
1038515463 8:28183929-28183951 GGCAGCCTGCATGTCAGTCCAGG + Intronic
1038532736 8:28331634-28331656 GGCAGGCACAATGGCAGGGCAGG - Intronic
1040546982 8:48406213-48406235 GGCACCCACAAAGGCAGGGCTGG - Intergenic
1041972578 8:63760686-63760708 GGCTGCCACCTTGGCTGTTCAGG - Intergenic
1045522981 8:102919512-102919534 GTCTGGCACCATGTCAGTGCTGG + Intronic
1045576616 8:103428604-103428626 GGCAGCTACCTTTGCAGAGCAGG + Intronic
1045604802 8:103760474-103760496 AAAATCCACCATGGCAGTGCTGG + Intronic
1045731870 8:105251740-105251762 TGCAACAAACATGGCAGTGCAGG + Intronic
1047307572 8:123665397-123665419 GACACCCAGCATGGCAGTGGAGG + Intergenic
1048438983 8:134445856-134445878 GGCAGCTACCACTGCAGGGCTGG + Intergenic
1049016316 8:139922626-139922648 GGCAGCCTCCATAGGAGGGCAGG + Intronic
1049262291 8:141646263-141646285 GGCAGGCGGCATGGCAGAGCAGG - Intergenic
1049661287 8:143820812-143820834 GGCGGCCTCCCTGGCAGGGCGGG - Intronic
1049713851 8:144080283-144080305 TGCAGCCACGCTGGCAGTGCTGG + Exonic
1051898249 9:22010602-22010624 TGCCACCACCATGGAAGTGCTGG + Intronic
1051986356 9:23092569-23092591 GGCATCCACCTTGGCAGTGATGG + Intergenic
1057462002 9:95271486-95271508 GGCGGCCAGCATGGCATTCCTGG - Intronic
1057730130 9:97601324-97601346 GGCAGCCACCATGGCAGTGCTGG + Exonic
1060149883 9:121281809-121281831 GGCTCCCACCCTGGCTGTGCTGG + Intronic
1060877164 9:127091738-127091760 GGGCGCTACCATGGCAATGCGGG - Exonic
1060896306 9:127219790-127219812 GGGCCCCACCCTGGCAGTGCAGG - Exonic
1061236925 9:129348768-129348790 GGCTTCCAACCTGGCAGTGCGGG - Intergenic
1061482186 9:130902791-130902813 AGCAGCCACAAGGGCAGGGCTGG - Exonic
1061793833 9:133072025-133072047 TGCAGCCACCATGATGGTGCAGG + Intronic
1062040404 9:134401871-134401893 GGCAGCCCCCAGGTGAGTGCGGG + Exonic
1062493733 9:136821888-136821910 GGCCGCCACCGTGGCCGTGAGGG + Intronic
1062565681 9:137163014-137163036 GGCGGCCACCCTGGCGGGGCGGG + Intronic
1185650404 X:1643519-1643541 TGTAGCCACCATGAGAGTGCGGG + Intergenic
1186819816 X:13276119-13276141 GGCAGAGACCATGGAAATGCTGG + Intergenic
1187468220 X:19544476-19544498 GGCAGCCACAGTCACAGTGCTGG - Intronic
1187688495 X:21839998-21840020 GGCTGCCACTGTCGCAGTGCGGG + Intronic
1189159923 X:38801277-38801299 GGCAGCCAGCTTGGCGGGGCTGG + Intergenic
1189307033 X:39994656-39994678 AGCAGGCACCATGGCAGGGAAGG - Intergenic
1190055836 X:47180466-47180488 GGCCGCAGCAATGGCAGTGCTGG - Exonic
1191025583 X:55909406-55909428 GAAAGGCGCCATGGCAGTGCAGG + Intergenic
1196031879 X:111100730-111100752 GGCTGCCACCTTGGCGGTGGGGG - Intronic
1197642306 X:128980478-128980500 TGCAGTAAACATGGCAGTGCAGG - Intergenic
1197693097 X:129523325-129523347 GGCAGCCACCGTGGCAGCCGCGG - Exonic
1197712268 X:129679735-129679757 GGCAGCCACCATGCCTGATCTGG + Intergenic
1198327301 X:135586549-135586571 GAGAGCCACCAGGGCAGTGGTGG - Intergenic