ID: 1057731571

View in Genome Browser
Species Human (GRCh38)
Location 9:97613514-97613536
Sequence AGAACACTGCCTCTTAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057731571_1057731580 23 Left 1057731571 9:97613514-97613536 CCAGCCTTAAGAGGCAGTGTTCT 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1057731580 9:97613560-97613582 TTTCGTACTACAAAATCCTGTGG No data
1057731571_1057731577 -4 Left 1057731571 9:97613514-97613536 CCAGCCTTAAGAGGCAGTGTTCT 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1057731577 9:97613533-97613555 TTCTGGGGGCCCTGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057731571 Original CRISPR AGAACACTGCCTCTTAAGGC TGG (reversed) Intronic
902225392 1:14993561-14993583 AGAACACTGCTTGTTAGGGCTGG - Intronic
903873256 1:26452720-26452742 AGAACACAGGCTCTGAAGCCAGG - Intronic
904623969 1:31791779-31791801 ACCACACTGCCTCTCAAGGTAGG - Intronic
904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG + Intronic
905252499 1:36658695-36658717 AGGACAGTGGCTCTGAAGGCAGG + Intergenic
906409762 1:45569062-45569084 ACAACACTGCCTTTTTAGCCAGG - Intronic
911297215 1:96132380-96132402 AGAACATTGCATCTTGGGGCCGG - Intergenic
913646209 1:120857325-120857347 AGAAATCTGCTTCTTAAGGCAGG + Intergenic
914080436 1:144405557-144405579 AGAAATCTGCTTCTTAAGGCAGG - Intergenic
914175343 1:145274081-145274103 AGAAATCTGCTTCTTAAGGCAGG - Intergenic
914530065 1:148515560-148515582 AGAAATCTGCTTCTTAAGGCAGG - Intergenic
916052036 1:161043180-161043202 AGAGCACTGCCTCTGGAGTCAGG - Intronic
917089643 1:171339964-171339986 AGAACCCTGCCTCTTGAGACTGG - Intronic
917647184 1:177040626-177040648 AGAACATAGCCTCTTTAGGTTGG - Intronic
918839239 1:189513260-189513282 ACAAGACTGCCTCTTTAGGCTGG + Intergenic
923341469 1:233010964-233010986 TGAACACTGACTCTCCAGGCAGG - Intronic
1063035638 10:2284249-2284271 AGAGAAATGCCTGTTAAGGCAGG + Intergenic
1064072727 10:12244730-12244752 AGAAAACAGCATCTTCAGGCTGG + Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1071438495 10:85668779-85668801 AAGACACTGCTTCTAAAGGCAGG + Intronic
1072477753 10:95779306-95779328 AGAACCAGGCCTCTTCAGGCTGG - Intronic
1074567568 10:114594840-114594862 AGAACAATGCCTGATATGGCAGG - Intronic
1078434569 11:11313748-11313770 AGAAAACTGGGGCTTAAGGCAGG - Intronic
1079030240 11:16981398-16981420 GGAACACTGGCTCTGAAGTCAGG - Intronic
1080245297 11:30173172-30173194 AGAACATTTCCTCTGAAAGCAGG - Intergenic
1083318640 11:61831732-61831754 TGAGCACTGCCACTTAAGCCAGG - Intronic
1085839756 11:79998125-79998147 TGAACACTGCATCTTCTGGCAGG + Intergenic
1089703692 11:120261387-120261409 GGAACTCTGGCTCATAAGGCTGG - Intronic
1094210553 12:27885586-27885608 ACAGCACTGCTTCTTGAGGCAGG + Intergenic
1094407984 12:30138773-30138795 AGCACACTGCTTCTTCTGGCAGG - Intergenic
1096255961 12:50062681-50062703 AGAACCCTGTTTCTCAAGGCTGG + Intronic
1102075859 12:110059677-110059699 TGTACACTGCCTCTTAAGAGGGG + Intronic
1102474891 12:113182240-113182262 AGAACACAGTCTCTGAAGCCAGG - Intronic
1103613853 12:122139968-122139990 TAAAAACTGCCTCTTATGGCCGG - Intronic
1104093176 12:125532809-125532831 AGAACACAGGTTCCTAAGGCCGG - Intronic
1113615857 13:111680354-111680376 TGAACACTGTCTCTGAAGGAGGG + Intergenic
1113621325 13:111765247-111765269 TGAACACTGTCTCTGAAGGAGGG + Intergenic
1115510478 14:34132970-34132992 AGAATACTTCCTCTTTAGGAGGG - Intronic
1115525855 14:34280028-34280050 AAACCACTACCTCTGAAGGCAGG + Intronic
1122469931 14:101959621-101959643 AGAACACCGCCTTCTAAGGTTGG + Intergenic
1122708193 14:103634897-103634919 AGAATATTACCTCTTAAGGATGG + Intronic
1202872511 14_GL000225v1_random:177543-177565 AGGACACTGCCTGTGAAGCCCGG + Intergenic
1123971672 15:25513639-25513661 ACAACACTGCCTCTTGTGGAGGG + Intergenic
1124208139 15:27740717-27740739 AGATCACTGCTTCTTCAGGCAGG - Intergenic
1125489661 15:40137151-40137173 AGAACTCTGCCTCAGAAGCCAGG + Intergenic
1126501272 15:49348114-49348136 AGATCACTCCCTGATAAGGCTGG + Intronic
1127445097 15:59053805-59053827 AGATCACTGCCTATTAACTCAGG - Intronic
1133135362 16:3707479-3707501 GAAACATTTCCTCTTAAGGCCGG - Intronic
1134772244 16:16819399-16819421 AGAACACAGCCTTTTCAGGTTGG + Intergenic
1144286048 17:13775635-13775657 AGAACACTGACTTTGAAGTCAGG + Intergenic
1146074216 17:29713037-29713059 AAAACACTGCCAGTTGAGGCTGG + Intronic
1146254875 17:31386087-31386109 AGGACACTGCTTCCTAAGCCAGG + Intergenic
1146354292 17:32120933-32120955 AGCACACTTCCTCTTGAGTCAGG + Intergenic
1152189614 17:78880389-78880411 AGAAAATTGCCTCGAAAGGCCGG + Intronic
1152408802 17:80111868-80111890 AGGTCGCTGCCTCTTCAGGCTGG - Intergenic
1157800044 18:50611862-50611884 AGAATACTGACTCTTTATGCAGG + Intronic
1158744575 18:60184560-60184582 AGAAATATGCCTCCTAAGGCTGG + Intergenic
1159139256 18:64372763-64372785 AGAACAGTGCCTCTTAGTTCTGG - Intergenic
1159911653 18:74151908-74151930 ACACCACTGCTTCTTAAGGGTGG - Intronic
1165150705 19:33758589-33758611 AGAACAATGCATCCCAAGGCCGG + Intronic
1166597964 19:44067554-44067576 AGAACAGTGGCTCTAGAGGCAGG - Exonic
1166904936 19:46101477-46101499 TGGACTCTGCCTCTTTAGGCTGG - Intergenic
925215196 2:2088374-2088396 AGAACACTGTCTCTTGAGATAGG - Intronic
927064502 2:19457679-19457701 AGAAAACTATCTCTTAGGGCTGG - Intergenic
929714327 2:44295037-44295059 AGAAGACATCCTCTTAAGCCAGG - Intronic
932765530 2:74466867-74466889 AGAATAAGGCCTCTTAGGGCAGG + Intergenic
933994152 2:87655549-87655571 TGTACACTGCTTCTAAAGGCAGG + Intergenic
934156672 2:89207485-89207507 TAAACTCTGCCTCTTCAGGCAGG - Intergenic
934210644 2:89975266-89975288 TAAACTCTGCCTCTTCAGGCAGG + Intergenic
935737068 2:106114810-106114832 AGAACACGAGCTCTCAAGGCTGG + Intronic
937158476 2:119738506-119738528 AGGACACTGACTCTTTAGCCAGG - Intergenic
941037018 2:160579926-160579948 AGGACACAGCCTCTGAGGGCAGG - Intergenic
942013548 2:171788849-171788871 AGAAGTCTGCCTCCAAAGGCAGG - Intronic
942456687 2:176142954-176142976 AGAACACTGCCTGACAAGGTTGG - Intergenic
942698151 2:178670058-178670080 AAAACATTGCCTCAAAAGGCAGG + Intronic
943252533 2:185546917-185546939 AGAAAACTGCCTCTTACAGTAGG - Intergenic
946736190 2:222756787-222756809 AGAACAATGGTTCTTAACGCTGG - Intergenic
947248359 2:228075098-228075120 AGCACAATGCCTATTAAAGCAGG + Intronic
947681895 2:232041545-232041567 AGAATTCTGGCTCTCAAGGCTGG - Intronic
947860763 2:233355430-233355452 AGAACACTGCTTCCTCAGGCAGG + Intronic
948151575 2:235748910-235748932 AGGAAACTGTCTCTGAAGGCTGG + Intronic
1171033597 20:21698735-21698757 AGAACACTGCCTTCCCAGGCTGG - Intergenic
1171085972 20:22238801-22238823 AGAATAATGCCTCTTAAGCCAGG - Intergenic
1173219848 20:41123298-41123320 AGAACTCTGCCTCTTGAGACTGG - Exonic
1174188697 20:48724736-48724758 AGTACACTGTCTCTTAATGCTGG + Intronic
1176987660 21:15456124-15456146 GCAACACGGCCTCTTTAGGCTGG - Intergenic
1178123822 21:29496300-29496322 AGAAGACTGCCTCTTATGTATGG + Intronic
1179183298 21:39062943-39062965 AGAACACTGCCTCTAAGTCCAGG - Intergenic
1180285589 22:10741933-10741955 AGGACACTGCCCCTGAAGCCCGG - Intergenic
1181719809 22:24764860-24764882 AGAACCCTGCCCCTTGAGACTGG - Intronic
1182079170 22:27517156-27517178 AGAACACTGCCTCATGACACTGG - Intergenic
949840036 3:8310549-8310571 AGAAAAATGCCTGTTAAGACGGG + Intergenic
950904118 3:16522068-16522090 ATTACACTGACTCTTAAGGAAGG + Intergenic
952013094 3:28924100-28924122 AGAATACTGCCTCTAAATGTAGG + Intergenic
959334966 3:105052552-105052574 CAAACACAGACTCTTAAGGCAGG - Intergenic
959912468 3:111779151-111779173 AGAACAGTGCTTCTTAAAGGTGG - Intronic
960972357 3:123148986-123149008 TGAACACTGCCTCCCCAGGCTGG - Intronic
961441314 3:126954928-126954950 AGAGCACAGCCTTCTAAGGCTGG + Intronic
962419810 3:135218035-135218057 TGAAAACTGCCTCATGAGGCAGG - Intronic
965689025 3:171335518-171335540 AGTACACAGCCTTTTGAGGCTGG + Intronic
967921877 3:194619906-194619928 AGACGACTACCTCCTAAGGCAGG + Intronic
972495650 4:39631708-39631730 AGAACACTGACTTCTAAGTCTGG + Intronic
973181724 4:47276934-47276956 AGAACCATGCCTCTAAAGCCAGG + Intronic
977556301 4:98490425-98490447 TTAAAACTGCCTCTGAAGGCTGG - Intronic
980471257 4:133255097-133255119 AGAAAACTGCCTTCTAAGGAAGG - Intergenic
980918557 4:139058765-139058787 AGAAAACTGCCTCTTACAGTAGG - Exonic
981713859 4:147733470-147733492 AGAACCCAGCCCCTCAAGGCTGG - Intronic
981742080 4:148013323-148013345 AGAACACATCCCCTGAAGGCAGG - Intronic
983036294 4:162870579-162870601 CCAACACAGCCTCGTAAGGCAGG - Intergenic
985119912 4:186630149-186630171 AGAACATTGCCTGGTAAGCCTGG - Intronic
989976428 5:50592815-50592837 AGAAATCTGCTCCTTAAGGCAGG + Intergenic
990677305 5:58202334-58202356 TTAACATTGCCTTTTAAGGCTGG - Intergenic
992501731 5:77350110-77350132 AGAGCACTGCCTCTCATCGCTGG + Intronic
996799836 5:127390823-127390845 AGAACACGGACTCTGGAGGCAGG + Intronic
996889237 5:128397889-128397911 AGAAAACTCCCTCGTAAGGTAGG + Intronic
998203049 5:140140586-140140608 AGAAGCCTGCCTCTTGAGGCTGG - Intergenic
998794338 5:145802041-145802063 ATGTCACTGCCTATTAAGGCAGG + Intronic
999533535 5:152489464-152489486 AGAACTCTGCCTATGAAGGTAGG + Intergenic
1001535232 5:172493355-172493377 ACACCACTGCCTCTTCAGGGAGG - Intergenic
1001718461 5:173836732-173836754 AGAACCCTACCTCTCAGGGCTGG + Intergenic
1002414604 5:179113201-179113223 AGAACACTGTCTGGCAAGGCCGG + Exonic
1004091538 6:12507661-12507683 AGAACACTGGCTTTGAAGGGTGG + Intergenic
1006309334 6:33246750-33246772 AGAACACCTCCTCATAAGGCTGG + Intergenic
1011592527 6:88984021-88984043 AGAACCCTTCCTCTTATGGGAGG + Intergenic
1020785070 7:12563360-12563382 AGAACAGTGTCTTTTGAGGCTGG - Intergenic
1023254252 7:38297396-38297418 ATACCACTGCCTCTCAACGCTGG - Intergenic
1025839910 7:65136546-65136568 AGAAGACAGTATCTTAAGGCTGG + Intergenic
1025883156 7:65559419-65559441 AGAAGACAGTATCTTAAGGCTGG - Intergenic
1025890290 7:65643187-65643209 AGAAGACAGTATCTTAAGGCTGG + Intergenic
1026043663 7:66889630-66889652 AGAACTCTGGTTTTTAAGGCAGG + Intergenic
1027162783 7:75814521-75814543 ACACCACTGCCTCTCCAGGCTGG + Intronic
1028530704 7:91835443-91835465 AGAACACCTCCTCTGAAGTCTGG + Intronic
1029212871 7:98923052-98923074 GGAACAGTGCTTCATAAGGCAGG - Intronic
1031960430 7:127984668-127984690 AAAACAGTGCATCTTAGGGCAGG - Intronic
1035054722 7:156026967-156026989 AGCAAACTGCCTCTTAAGGAAGG - Intergenic
1037112306 8:15178091-15178113 AGGACACTGCCTCCTGAGCCTGG + Intronic
1037282980 8:17264211-17264233 ACAGCACTGCCTCTCAAGTCAGG - Intronic
1038668544 8:29562747-29562769 AGGACACTGCCCCTTTAGGAAGG - Intergenic
1041257031 8:55987763-55987785 AGAGCACAGACTCTTAAGCCTGG + Intronic
1045166490 8:99612173-99612195 AGAACACAGTCTCTAAAGCCAGG - Intronic
1045996798 8:108372437-108372459 AGAACACTGCCTTTTAAACGGGG - Intronic
1050495230 9:6234004-6234026 AGAACACTGTCTCAAAAAGCAGG - Intronic
1053369774 9:37551140-37551162 ACAACACTAAATCTTAAGGCTGG + Intronic
1055160058 9:73115536-73115558 AGAAAACTACCTCTTAATGGGGG + Intergenic
1055501358 9:76905757-76905779 GGAACTCTGGCTCTTAAAGCTGG - Intronic
1056812444 9:89775130-89775152 GGAAGACTGCCCCTTAAGGAAGG - Intergenic
1057731571 9:97613514-97613536 AGAACACTGCCTCTTAAGGCTGG - Intronic
1059051273 9:110929006-110929028 AGAACACTGCATTTTAAGTTGGG - Intronic
1060367409 9:123032134-123032156 AAAACACTGGCTCTTAAGGAAGG + Intronic
1186555536 X:10554423-10554445 AGAAAACTGCCTCGTAGGTCAGG - Intronic
1187580457 X:20602170-20602192 AGGACACTTCCTCTGAAGGCAGG - Intergenic
1195004504 X:100672596-100672618 AGAACATTGCCTCTAGAGCCAGG - Intergenic
1195462670 X:105145330-105145352 AGACCACTTCCAATTAAGGCTGG + Intronic
1199025192 X:142928296-142928318 GGAACACTCCCTCCTAATGCGGG + Intergenic