ID: 1057734300

View in Genome Browser
Species Human (GRCh38)
Location 9:97639686-97639708
Sequence GATGCTGCTGCTAAACACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057734300 Original CRISPR GATGCTGCTGCTAAACACTT TGG (reversed) Intronic
900174994 1:1287686-1287708 GAGGCTGCTGCTCAACCCTGAGG - Exonic
902294415 1:15456762-15456784 GACGCTGCTGCTGTCCACTTTGG + Exonic
906696935 1:47829357-47829379 GCTGCAGCTTCTAAACACTTGGG - Intronic
906800680 1:48734391-48734413 GATGCTGCTGCCATAGACTAAGG - Intronic
908114391 1:60926630-60926652 GATGTTACTGCTAATCACTTAGG - Intronic
908425831 1:64006411-64006433 CATGCTGCTGCCACCCACTTTGG - Intronic
908808043 1:67951033-67951055 TATGCTGCTTTTAAACACCTTGG - Intergenic
909232153 1:73104970-73104992 GAAGCTGCTGCTGACCACTCGGG - Intergenic
910775618 1:90871763-90871785 GATGCCTCTGATAAACTCTTAGG - Intergenic
911254181 1:95615100-95615122 GATACTTCTGCAATACACTTTGG + Intergenic
913508042 1:119536924-119536946 CATGCTTCTGATTAACACTTGGG + Intergenic
914936367 1:151984310-151984332 AATGCTGCTGCTATACTTTTAGG - Intronic
915431438 1:155869855-155869877 AATGCTGCAGTTAAACACTTGGG + Intronic
916071150 1:161170704-161170726 GAAGCAGCTGCTACACAATTAGG + Exonic
918121132 1:181541615-181541637 GCAGCTGCTGCTAAGCACTGCGG - Intronic
923143790 1:231183919-231183941 TATGCTGCTTCTTCACACTTGGG - Intronic
924108545 1:240674386-240674408 AATGCTGCTCCTAGGCACTTAGG + Intergenic
1064703443 10:18046030-18046052 CATGCGGCTACTAACCACTTGGG + Intergenic
1065683008 10:28256254-28256276 GATGCTGTAGCTAAACCATTAGG + Intronic
1065763213 10:29002445-29002467 GATCCTGCGGCTGAACACTCAGG + Intergenic
1066045584 10:31592761-31592783 GAAGCTGGTGTTAAACTCTTGGG - Intergenic
1067047749 10:42994804-42994826 GATGATGCTGCTATAAACTTTGG - Intergenic
1067984042 10:51122051-51122073 CATGTCGCTGCTAAACATTTTGG + Intronic
1069843012 10:71351714-71351736 GATGCTGCTGCTGAAGACAGTGG - Exonic
1078247886 11:9592659-9592681 GATGCTGCTGCTTAAGAACTGGG - Intronic
1080251627 11:30240156-30240178 GATGCTGCTGCTTCTCACTAGGG - Intergenic
1081692747 11:45089193-45089215 GATGCTACTGCAAAGCACTGGGG + Intergenic
1083913804 11:65727054-65727076 GCTGCTGCTGCTGCCCACTTGGG - Intergenic
1085861421 11:80240456-80240478 GAAGCTGCTGCTAAGAACTGTGG + Intergenic
1087836566 11:102880865-102880887 GATGCTGCTGCTTTAAACCTTGG + Intergenic
1088423296 11:109672352-109672374 CATGCTGATCCTAAAAACTTTGG + Intergenic
1091047518 11:132337545-132337567 CTTGCTGCTGCGAAAAACTTGGG - Intergenic
1091065851 11:132510742-132510764 CATGCTGCTGATAAAGACATAGG - Intronic
1093967697 12:25344980-25345002 GATCCAGCTGAAAAACACTTTGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096753506 12:53779321-53779343 CCTGCTACTGGTAAACACTTTGG - Intergenic
1097102983 12:56602372-56602394 GCTGCTGCTGCTGATTACTTGGG - Intronic
1097538353 12:60902418-60902440 TATTCTGTTGATAAACACTTAGG - Intergenic
1106302082 13:28476761-28476783 GTTGCTGGTGTTAAACATTTAGG - Intronic
1107720541 13:43243773-43243795 GATGCTGCTGCTTGGCATTTTGG + Intronic
1109234058 13:59793722-59793744 GTTGCTGGTGATAAAAACTTGGG - Intronic
1112383317 13:98914516-98914538 GATGCTCCTGGGAAACACTTGGG + Intronic
1114294833 14:21319706-21319728 GATGCTGCTGTCAAAAAGTTTGG + Intronic
1115327245 14:32153807-32153829 GATGCGGTGGCTCAACACTTTGG + Intronic
1117512168 14:56463521-56463543 GAGGCTGCAGATGAACACTTAGG + Intergenic
1117572799 14:57064872-57064894 GGTGCTGCTGGTTCACACTTAGG + Intergenic
1118132878 14:62987122-62987144 TGAGCTGCTGCAAAACACTTCGG + Exonic
1118492596 14:66276058-66276080 TATGTTGGTGCTAAACACCTTGG + Intergenic
1118717256 14:68569236-68569258 GCTGCTTCTCCTAAACAATTTGG - Intronic
1120152892 14:81056986-81057008 GATCATGCAGTTAAACACTTGGG - Intronic
1126937750 15:53730066-53730088 AATGATGCTGCTATACACATGGG - Intronic
1130858403 15:87862856-87862878 GATGCTGCTGTTATTCATTTTGG - Intronic
1132211284 15:100024514-100024536 AATGATGTTGCTCAACACTTTGG - Intronic
1133235329 16:4384887-4384909 GAGGCTGCTGCTGAACACGGCGG + Intronic
1136105603 16:28027995-28028017 GATGCTGCTGCTGAGGCCTTAGG - Intronic
1138038157 16:53629445-53629467 GATGCTGATGCTGAACTCTGGGG + Intronic
1138248489 16:55484613-55484635 GATGATGCTGGTAGACACTGAGG + Intronic
1141280534 16:82626952-82626974 GATGCTGCTGCTGATCTATTTGG + Exonic
1142987988 17:3708781-3708803 AATGCTGCTGCTAAATGCTGGGG - Intergenic
1144472668 17:15558675-15558697 GATTCAGCTTCTAAACACCTGGG - Intronic
1144923814 17:18786016-18786038 GATGCAGCTTCTAAACACCTGGG + Intronic
1150027669 17:61694466-61694488 AATGCTGCTATTAAACATTTGGG + Intronic
1150673341 17:67221915-67221937 GCTCCTGCTGCCACACACTTGGG + Intronic
1150866138 17:68852335-68852357 GATGCTCCTGCTCAAGTCTTTGG + Intergenic
1151596167 17:75079133-75079155 GCGGCTGCTGCTACCCACTTGGG - Intergenic
1153408635 18:4768802-4768824 TATGCTGCTCATAAACAGTTTGG - Intergenic
1155013786 18:21811416-21811438 AATGCTGCTGCTAAAAACACAGG - Intronic
1158280960 18:55825757-55825779 AATGCTGCTGCTATAAACATGGG + Intergenic
1158534742 18:58297397-58297419 GATGCTGTTGCTTAGCACTGTGG + Intronic
1158820124 18:61149890-61149912 GATCCTGCTGCCGAACACATTGG - Intergenic
1160266605 18:77344100-77344122 GATGCTGCTTCTAGGCACTGTGG + Intergenic
1162201009 19:9020006-9020028 GATGCTGCTGCTTAAGACCTTGG + Intergenic
927098529 2:19767487-19767509 GCTGCTGCTGCTTAAGATTTAGG - Intergenic
928642358 2:33313646-33313668 AATGCTGCTGCTAAGGACATGGG + Intronic
929438188 2:41944775-41944797 GATCCTGATTCTACACACTTTGG + Intronic
930358535 2:50348746-50348768 GATGCTGGTGATTAAGACTTGGG + Intronic
930521812 2:52477157-52477179 AATGCAGCTTCTAATCACTTTGG + Intergenic
931044880 2:58340659-58340681 GCTGCAGCTGCTTAAGACTTTGG - Intergenic
932720511 2:74135552-74135574 GATGCTGCTGCTTAAGACCTTGG - Exonic
936719769 2:115237000-115237022 GTTGCTGCTGCTATACATTAAGG - Intronic
938591267 2:132738436-132738458 GATGCTGGTGTTAAACAGTATGG - Intronic
940754390 2:157665368-157665390 GATATTGCTGCTAAAGAATTTGG + Intergenic
941204679 2:162557295-162557317 GATGCTTCTTCTAGAAACTTAGG - Intronic
943064568 2:183072349-183072371 GAAGCTGCTGCTGCCCACTTGGG + Intergenic
943660953 2:190558701-190558723 GAAGATTCTGCTAAACATTTGGG + Intergenic
944230158 2:197384428-197384450 GATGATGCGGCTAAACCATTAGG - Intergenic
944314933 2:198274059-198274081 GATGCTGATGATAAAAAATTGGG + Intronic
945593129 2:211759093-211759115 GAAGCTTCTGCCAAAAACTTTGG + Intronic
946831771 2:223735080-223735102 GCTATTTCTGCTAAACACTTGGG - Intergenic
1169641727 20:7759657-7759679 GATGCTGATGGAAAACACATCGG + Intergenic
1171400914 20:24872642-24872664 GATGCTGCTGGTAGTCACTATGG - Intergenic
1173405041 20:42757183-42757205 AAGGCTCCTTCTAAACACTTTGG + Intronic
1174431659 20:50474242-50474264 CATTCTGCTGTTGAACACTTGGG - Intergenic
1184030130 22:41888622-41888644 GATGCTGCTGATGGACATTTGGG + Intronic
949239156 3:1849338-1849360 GACGCTGCTCCCAAAGACTTGGG + Intergenic
949822011 3:8125801-8125823 CATTCTGATGGTAAACACTTAGG + Intergenic
953073096 3:39543133-39543155 GCTACTGCTGCTAAACTGTTTGG - Intergenic
954512189 3:51135383-51135405 GATGCTCAGTCTAAACACTTAGG + Intronic
957429611 3:80085099-80085121 GATGATGCTGCTACAAACTAAGG + Intergenic
958730432 3:97955008-97955030 GATGCTGCTTCCAAGCTCTTAGG + Intronic
964311011 3:155392349-155392371 GATGCTGGTTCTAAGTACTTAGG + Intronic
965028961 3:163338821-163338843 GATGCTACTGGCAAACAATTAGG - Intergenic
966561596 3:181326613-181326635 AATACTGGTGCTAAACACATTGG - Intergenic
967702300 3:192607263-192607285 GATACTGCTCCTGAACACATGGG - Intronic
968180228 3:196589404-196589426 GATGATGTTGCTAAACAAGTTGG + Intergenic
968907422 4:3461116-3461138 CATGCTGCTGCTGGACACTGTGG - Intergenic
969185563 4:5471706-5471728 GATTCTGATGCTAAACAGTTTGG + Intronic
969481911 4:7451266-7451288 GCTGCTGCTGCTGAAGACCTAGG - Intronic
972787455 4:42340391-42340413 GAAGCTGCTGCTAAGCACGAAGG - Intergenic
976534927 4:86201244-86201266 TCTTCTGCTGATAAACACTTAGG + Intronic
981509256 4:145537586-145537608 TCTTCTGCTGCTAAATACTTGGG - Intronic
981586559 4:146309516-146309538 GATGCTGCTGCTGCTGACTTGGG + Intronic
981667219 4:147243286-147243308 GAGGCTGCTGCTAAACCTTCTGG - Intergenic
982325674 4:154126245-154126267 GATCCTGCTGCTCAAAGCTTAGG - Intergenic
987715463 5:21563613-21563635 GATGATGCAGCAATACACTTCGG - Intergenic
990855948 5:60266515-60266537 GCTGCTGCTGCTTCACCCTTGGG + Intronic
993992949 5:94682716-94682738 TATGTTGTTTCTAAACACTTTGG + Intronic
994124976 5:96158738-96158760 GATGCTGTGGCTAAACACAAGGG + Intergenic
996724586 5:126663287-126663309 GATGCTGCTGCTTAAGACCTTGG - Intergenic
1000268264 5:159658535-159658557 AATGCTGCTGCTAAACTTTCGGG + Intergenic
1001931061 5:175673339-175673361 GTTGCTCAGGCTAAACACTTAGG - Intronic
1004451870 6:15754943-15754965 AATGCTGCTCCTAAGCACATCGG - Intergenic
1006653627 6:35571379-35571401 GATGCCTCTGCTTAACACGTTGG + Intergenic
1009001261 6:57718431-57718453 GATGATGCAGCAATACACTTCGG + Intergenic
1012532171 6:100251212-100251234 GATGGAGCTGATTAACACTTAGG + Intergenic
1012765515 6:103362689-103362711 GATGCTGCTTCTAAAAGCCTAGG + Intergenic
1015650899 6:135458066-135458088 GATGCAGCAGGTAAACACTTTGG + Intronic
1015794739 6:136999779-136999801 GATGATGATGACAAACACTTAGG + Intergenic
1017306442 6:152923523-152923545 GCTGCTGCTGCTAGAGAATTGGG - Intergenic
1018283599 6:162214295-162214317 GATTCTGCTGCTCAAAACCTAGG - Intronic
1023341272 7:39222836-39222858 GATGATGCTGCTACAAACATGGG + Intronic
1026047889 7:66920464-66920486 CATACTGCTGCTAAAAACATTGG + Intergenic
1029938927 7:104458977-104458999 GAGGCTGCTGCTGAAAGCTTAGG - Intronic
1030413243 7:109209067-109209089 TATGCTACTGATAAACATTTAGG - Intergenic
1030885476 7:114931215-114931237 GATTCTTCTTCTAATCACTTAGG + Intronic
1032207026 7:129874966-129874988 GAGGCTGCTGGGAAACACGTGGG + Intronic
1033351627 7:140566910-140566932 AATGCTGCTGCTAGAGAATTTGG - Intronic
1034741527 7:153478511-153478533 GCTGCAGCTGCTTAGCACTTGGG - Intergenic
1037208484 8:16355241-16355263 TATAAGGCTGCTAAACACTTGGG + Intronic
1038191877 8:25329759-25329781 TCTGCTGCTGATAAACACGTGGG - Intronic
1038323554 8:26552022-26552044 AATGCTGGTCTTAAACACTTAGG + Intronic
1039023222 8:33229879-33229901 GCTGCTTCTGGAAAACACTTCGG + Intergenic
1047688912 8:127330703-127330725 GATTCTGCTACTAACCAATTGGG + Intergenic
1049067339 8:140327459-140327481 AATGCTGCTGCTATGCACATTGG - Intronic
1052796272 9:32926405-32926427 GATGCAGCTGCCTAAAACTTCGG + Intergenic
1055382652 9:75725756-75725778 GATCCTGGAGCTAAACACCTAGG + Intergenic
1056285378 9:85082355-85082377 GGTGCTTCTGCTAAGCAGTTTGG + Intergenic
1057734300 9:97639686-97639708 GATGCTGCTGCTAAACACTTTGG - Intronic
1188041062 X:25370017-25370039 GCTGCAGCTGCTTAAGACTTGGG + Intergenic
1189592662 X:42531419-42531441 GATGCTGCAGCTAAAAGTTTGGG + Intergenic
1198221659 X:134608227-134608249 AATAGTGCTGCTAAACATTTGGG - Intronic
1198318090 X:135489697-135489719 GATCTGGCTGCTAAGCACTTTGG - Intergenic
1200227308 X:154425764-154425786 GATTCTTTTGCTAATCACTTTGG - Intergenic
1200629871 Y:5569810-5569832 GATGTTTCTGCTACACAGTTTGG - Intronic
1200947566 Y:8861891-8861913 GTTGCTTCTGCTACACATTTTGG + Intergenic
1201887510 Y:18901734-18901756 TATGGTGCTGCTGAGCACTTAGG + Intergenic