ID: 1057736307

View in Genome Browser
Species Human (GRCh38)
Location 9:97664752-97664774
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057736305_1057736307 -4 Left 1057736305 9:97664733-97664755 CCAGCTATGTGCAGAGTCTCAGC 0: 1
1: 0
2: 2
3: 16
4: 141
Right 1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG No data
1057736304_1057736307 27 Left 1057736304 9:97664702-97664724 CCAGACTGTTGGGAGAGAAAACT 0: 1
1: 1
2: 0
3: 13
4: 182
Right 1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr