ID: 1057739113

View in Genome Browser
Species Human (GRCh38)
Location 9:97696818-97696840
Sequence GTTTAGGGATGCAGCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739113_1057739123 30 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739113_1057739120 24 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739113_1057739118 19 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739118 9:97696860-97696882 CAGCCGAGGTGCAGCGAAGAAGG No data
1057739113_1057739122 26 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739122 9:97696867-97696889 GGTGCAGCGAAGAAGGCCCGGGG No data
1057739113_1057739121 25 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739121 9:97696866-97696888 AGGTGCAGCGAAGAAGGCCCGGG No data
1057739113_1057739116 5 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739113 Original CRISPR GTTTAGGGATGCAGCCGCCC CGG (reversed) Intronic
900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG + Intergenic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
901934176 1:12616680-12616702 CTTCAGAGCTGCAGCCGCCCAGG + Intronic
917222648 1:172748409-172748431 CTGTAAGCATGCAGCCGCCCGGG - Intergenic
919479438 1:198069342-198069364 TGTTAGGGAAGCAGGCGCCCAGG - Intergenic
923631510 1:235651663-235651685 TTTTAGAGATGCAGACTCCCAGG + Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063462480 10:6223375-6223397 GTCTAGGGATTCAGCTGCACTGG - Intronic
1065124422 10:22560326-22560348 GTTTGGGGAGCCCGCCGCCCTGG + Intronic
1071888667 10:89978583-89978605 ATTTGAAGATGCAGCCGCCCAGG - Intergenic
1072019364 10:91383026-91383048 GTTTGGAGATGCAGCCTCACAGG + Intergenic
1076224340 10:128762021-128762043 CTTCAGGGAAGCAGCAGCCCAGG - Intergenic
1083969031 11:66061280-66061302 GTTTAGGGATGGAGGGGCCAAGG + Intronic
1084752158 11:71211045-71211067 AATTAGGGCTGCAGCAGCCCTGG - Intronic
1088789487 11:113211762-113211784 GTTCAGGGATGCAGGGGCCTCGG + Intronic
1089469746 11:118711080-118711102 GTTTGGAGATGGAGTCGCCCAGG + Intergenic
1090520166 11:127470667-127470689 GTTTAGCCATGCAGCCACCAGGG + Intergenic
1090981203 11:131724202-131724224 GGTGAGGGGTGCAGGCGCCCTGG - Intronic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1091821888 12:3481540-3481562 GTACTGGGATGCAGCAGCCCTGG + Intronic
1102079311 12:110085215-110085237 GTTTAGGGTTGCAGAAGACCTGG - Intergenic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1105410644 13:20168534-20168556 GATTAGGAATCCAGCAGCCCAGG + Intergenic
1106248980 13:27969804-27969826 GTTTGGGGCTGCAGTCGTCCGGG - Exonic
1116862114 14:50003293-50003315 GCTCACGGCTGCAGCCGCCCGGG + Intronic
1124870746 15:33539605-33539627 GGTTAGGGATGCTGACCCCCTGG + Intronic
1128705459 15:69834760-69834782 GTTTAGGGGTCCAGCCCCCCGGG - Intergenic
1132945327 16:2529012-2529034 GTGCAGGGATGCAGCCTCCAGGG - Exonic
1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG + Intronic
1133338209 16:5020345-5020367 GTTTTGGGATGCAGCTCTCCAGG - Intergenic
1140456327 16:75107652-75107674 CTCTTGGGATGCAGCTGCCCTGG + Intronic
1143897140 17:10145147-10145169 GCTCAGGGCTGCAGACGCCCTGG + Intronic
1145276699 17:21435698-21435720 GTCAAGTGATGCAGCCTCCCGGG - Intergenic
1146728682 17:35175702-35175724 ATTTAGGGATGCAACCACCCAGG - Intronic
1154315620 18:13301131-13301153 GTTTAGGGATGCTGCCTACTCGG + Intronic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1161015787 19:1982338-1982360 GTTTTGGGATTCTGTCGCCCGGG - Intergenic
1161569096 19:5020467-5020489 GTTGAAGGGTGCAGCCGCCGTGG - Intronic
1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG + Exonic
1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG + Intronic
928179494 2:29058013-29058035 ATTTAGGGATGCTGACTCCCAGG - Exonic
928370130 2:30734591-30734613 GTTTAGGGAAGCAAGCTCCCAGG - Intronic
935679054 2:105620336-105620358 GGGTAGGGATGCACCCCCCCAGG - Intergenic
936596502 2:113853278-113853300 GCTTAGGGATACAGCCCCCGAGG + Intergenic
937004221 2:118496617-118496639 GCTGTGGGATGCGGCCGCCCTGG + Intergenic
938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG + Intergenic
939378297 2:141399479-141399501 GTTTGGGGATGTAGCCGCTGGGG - Intronic
942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
948753003 2:240143325-240143347 GGTTAGGGATGCAGAATCCCAGG - Intronic
1175124914 20:56744164-56744186 GTTTATGGATGCAGAAACCCAGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949463027 3:4314324-4314346 GTTTAGGTATGCAGCCACAAGGG - Intronic
958914454 3:100033257-100033279 GTTCAAGGATGCAGCCTGCCTGG - Intronic
962351081 3:134656188-134656210 GTTTGGGGATGTAGCCTTCCTGG - Intronic
967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG + Intergenic
968642043 4:1719862-1719884 GTTTGAGGATGCAGCTGCCTGGG - Intronic
981093679 4:140757333-140757355 GTCTAGGGATAAAGCTGCCCTGG - Intergenic
992018646 5:72600453-72600475 GTTGTGTGATGCAGCAGCCCTGG - Intergenic
1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG + Intronic
1001274425 5:170339987-170340009 GTTTAGGGAAGCAGGCACTCAGG - Intergenic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1018087922 6:160320982-160321004 GTTTAGGGATTCAGTGGCCAAGG + Intergenic
1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG + Intergenic
1022093833 7:27125666-27125688 GTTTAGGGATGCAGAGACCAGGG + Intronic
1022108730 7:27214682-27214704 CTTTGGGGCTGCAGCCACCCAGG - Intergenic
1022566944 7:31413275-31413297 CTTTAGGGATGCAGGAACCCAGG - Intergenic
1029402644 7:100355474-100355496 GTTTTGGGAGGCACCGGCCCTGG - Intronic
1034645836 7:152646500-152646522 TTTTAGAGATGGAGTCGCCCAGG + Exonic
1035789397 8:2289898-2289920 GTTTAGGGATGCAGTCGTGAGGG - Intergenic
1035803408 8:2431807-2431829 GTTTAGGGATGCAGTCGTGAGGG + Intergenic
1037808038 8:22069302-22069324 TTGGAGGGATGCAGCCGGCCAGG + Intronic
1040280219 8:46037126-46037148 CTTCAGGGATCCACCCGCCCTGG - Intergenic
1041470984 8:58208831-58208853 GTGGAGGGATGCAGGCTCCCAGG - Intergenic
1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG + Intergenic
1045656878 8:104396184-104396206 GTGTAGGAATGCAGCAGCCCAGG - Intronic
1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059377697 9:113898753-113898775 GATCAGCGATGCAGCAGCCCGGG + Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1061506452 9:131034347-131034369 GTTTAGGCAGGCAGCACCCCAGG - Intronic
1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG + Intronic