ID: 1057739114

View in Genome Browser
Species Human (GRCh38)
Location 9:97696833-97696855
Sequence CAGCTTCGATTTTTCGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739114_1057739118 4 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739118 9:97696860-97696882 CAGCCGAGGTGCAGCGAAGAAGG No data
1057739114_1057739128 26 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739114_1057739126 18 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739126 9:97696874-97696896 CGAAGAAGGCCCGGGGCTGGGGG No data
1057739114_1057739121 10 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739121 9:97696866-97696888 AGGTGCAGCGAAGAAGGCCCGGG No data
1057739114_1057739124 16 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739124 9:97696872-97696894 AGCGAAGAAGGCCCGGGGCTGGG No data
1057739114_1057739122 11 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739122 9:97696867-97696889 GGTGCAGCGAAGAAGGCCCGGGG No data
1057739114_1057739116 -10 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739114_1057739127 23 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739114_1057739125 17 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739125 9:97696873-97696895 GCGAAGAAGGCCCGGGGCTGGGG No data
1057739114_1057739123 15 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739114_1057739120 9 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739114 Original CRISPR CAGCTTCGATTTTTCGTTTA GGG (reversed) Intronic
910364411 1:86448848-86448870 CACCTTTCATTTTTTGTTTATGG + Intronic
911464914 1:98239325-98239347 CAACTTTTATTTTTAGTTTATGG - Intergenic
913012230 1:114695343-114695365 CAGCTTTGATCATTCATTTAGGG - Intronic
916298509 1:163247221-163247243 CAGCTTTTATTTTAGGTTTAGGG - Intronic
916805167 1:168252365-168252387 CAGCTGCAATTTGTCCTTTAAGG - Exonic
916984062 1:170171567-170171589 CAGCTTCCATTTTTTGCTAATGG + Intergenic
917216577 1:172684835-172684857 CAGTTTCAATCTTTCGTATATGG + Intergenic
917338170 1:173946870-173946892 CAGATTTGATTCTTCTTTTAAGG + Intronic
918614324 1:186527037-186527059 CAGTTTCGATTTTCTGTATATGG + Intergenic
918799710 1:188956800-188956822 CAGCTTCAATTTTTAGCATATGG - Intergenic
918883667 1:190161913-190161935 CAGCATTGATATTTCGTTAAAGG - Intronic
921823108 1:219640461-219640483 GAGCTTTGATTTTTCACTTAGGG - Intergenic
924892824 1:248302934-248302956 GATATTCGATTTTTGGTTTAGGG + Intergenic
1069058466 10:63868750-63868772 CAGCTTCCAATTTGCTTTTAAGG - Intergenic
1073211087 10:101803165-101803187 CAGCTTACATTTATCTTTTATGG - Intronic
1076030403 10:127152848-127152870 CAGCTTTGCTTTTGCTTTTAAGG + Intronic
1083469658 11:62875118-62875140 CAGCTTTGATGTTTTGTTTCTGG + Intronic
1086132676 11:83417913-83417935 CAACTTCTATTTTTGGTTCAAGG - Intergenic
1087972331 11:104499925-104499947 CAGCTTCCATTTTCCGCATATGG - Intergenic
1088681396 11:112245898-112245920 CAGCTTTGTTTTTTGGTTTGGGG - Intronic
1092580058 12:9830273-9830295 CAGCTACTATTTTTTGTTTCTGG + Intronic
1093056246 12:14558572-14558594 CACCTTCCTTTTTTCTTTTATGG - Intronic
1097442178 12:59622895-59622917 CAGCTTTGTTTTTTCATCTATGG + Intronic
1097776523 12:63652912-63652934 CAACTTCTATTTTACGTTCATGG - Intronic
1102383673 12:112488538-112488560 CAGTTTCTGTTTTTAGTTTATGG + Intronic
1109255358 13:60073603-60073625 CTGCCTCTATTTTTCATTTATGG + Intronic
1110402921 13:75115251-75115273 CAGCTTCTATTTTAGTTTTAGGG + Intergenic
1122588496 14:102827618-102827640 CAGTTTGGATTTTTGGATTAGGG + Intronic
1124399121 15:29333265-29333287 CAGCTTCTATTTTCTGCTTATGG - Intronic
1137297934 16:47114745-47114767 CAGCCTGAATTTTTCTTTTATGG + Intronic
1138902638 16:61292786-61292808 CTGCTTCCATTTTTCTTTAATGG + Intergenic
1138943773 16:61822436-61822458 CAGATTTGATTTTTCCTTTTGGG - Intronic
1145827478 17:27887941-27887963 AGGCTTAGACTTTTCGTTTAAGG + Intronic
1148624982 17:49062400-49062422 CAGCTTCGAGTTGTCTCTTAAGG - Intergenic
1203169431 17_GL000205v2_random:134702-134724 CAACTTCTATTTTAAGTTTAGGG - Intergenic
1152968847 18:142127-142149 CTGCTTCTATTTTTGGTCTATGG - Intergenic
1155045140 18:22096674-22096696 CAGTTTCCATTTTTCCTTTTGGG - Intronic
1156095958 18:33531832-33531854 CAACTTCTATTTTAAGTTTAGGG - Intergenic
1163898753 19:20082079-20082101 TAGCTTTTATTTTTGGTTTAGGG + Intronic
1164241003 19:23389136-23389158 AAACTTCTATTTTTGGTTTAGGG - Intronic
1164864266 19:31590864-31590886 CTGCCTCAATTTTTCCTTTAGGG - Intergenic
937193365 2:120126317-120126339 CATCTTCAGTTTTTCTTTTATGG + Intronic
937569475 2:123338293-123338315 CAGCTTCAATCTTTTGCTTATGG - Intergenic
938338193 2:130517481-130517503 CAGCTTCCATTTTTACTTCAGGG + Intergenic
938351645 2:130603270-130603292 CAGCTTCCATTTTTACTTCAGGG - Intergenic
941086704 2:161126362-161126384 CAGTTTGAATTTTTAGTTTAAGG - Intergenic
942509436 2:176681283-176681305 GAACTTCGATTTCTCTTTTATGG - Intergenic
943053563 2:182946576-182946598 CAACTTCTATTTTACGTTCAGGG - Intronic
944156574 2:196613247-196613269 TAACTTGGATTTTTAGTTTATGG - Intergenic
945171086 2:206995784-206995806 CAGCCTCAAGTTTTCCTTTATGG + Intergenic
1173331018 20:42076392-42076414 CAGCTTCTCTTTTCCCTTTAGGG + Exonic
1175013347 20:55762694-55762716 CAGCATTGATTTTTGGTTTTTGG - Intergenic
1177325339 21:19580047-19580069 AAGCTGCCATTTTTCTTTTAGGG + Intergenic
1177662613 21:24105637-24105659 CAACTTCTATTTTACATTTAGGG - Intergenic
1182002696 22:26933769-26933791 CATCTTCTATCTTTCCTTTAGGG + Intergenic
949924721 3:9032028-9032050 CTACTTCAATTTTTAGTTTAAGG + Intronic
954942731 3:54389543-54389565 TAACTTCGATTATTTGTTTAAGG - Intronic
958748557 3:98166541-98166563 CAGCTTCAATTTTTCCTACAGGG + Intergenic
959858216 3:111186503-111186525 CAGTTTCGATTTTCTGTATATGG - Intronic
962177057 3:133166331-133166353 CAACTTCTATTTTTAGTTTACGG - Intronic
965391577 3:168110809-168110831 CAGCTTATATTTTTCTATTAGGG + Intergenic
966239694 3:177742787-177742809 CAGCCTTGATTTTTTATTTATGG - Intergenic
970561477 4:17285767-17285789 CAGCTTCTTTTTTGCCTTTATGG - Intergenic
970938476 4:21602999-21603021 CAGCTTTGATTATTCCTTTTTGG + Intronic
972968081 4:44537453-44537475 ATGCTTCAATTTTTCATTTATGG - Intergenic
973079414 4:45971200-45971222 CAGCTTACCTTTTTCCTTTAAGG + Intergenic
978462495 4:108972014-108972036 CAGCTTCGATTTACCTCTTATGG + Intronic
978960434 4:114671374-114671396 CAGCTTTGTTTTTTTGTTTTTGG - Intronic
979564440 4:122138333-122138355 CAGCTTTTATTTTAGGTTTAGGG + Intergenic
981441680 4:144790769-144790791 CAGCTTTGATTTTTGTTTTCTGG + Intergenic
982872477 4:160600263-160600285 CATCTCCGATTTTTAGTTTATGG + Intergenic
986100751 5:4608561-4608583 CAGCTTCAATCTTTTGTATATGG - Intergenic
986789575 5:11146418-11146440 CAGCTTCGAATTTTGGTTTGTGG + Intronic
987853065 5:23381901-23381923 TAGCTTTGATTTTTCATTTAAGG - Intergenic
990134080 5:52624145-52624167 CAACTTCTATTTTACGTTCAGGG + Intergenic
990730048 5:58798465-58798487 AATCTTGGATTTTTGGTTTAGGG - Intronic
992417667 5:76567231-76567253 CACCTTGGATTTTTGGATTAGGG - Intronic
993577489 5:89620510-89620532 CAGTTTCCATTTTTTGCTTATGG + Intergenic
994307904 5:98228887-98228909 CAGTTTCAATTTTCCGTATATGG - Intergenic
995170599 5:109107263-109107285 CAGTTACCATTTTTCTTTTAGGG + Intronic
997181587 5:131834319-131834341 CAGCTTCCCTTTTTTGTTTGTGG + Intronic
1000557155 5:162740384-162740406 CAGCTTCAATTTTCTGTCTATGG + Intergenic
1002813325 6:656076-656098 CAGCTTAGATTTTTTTTTTAAGG - Exonic
1003861183 6:10322949-10322971 CAGCTTAGATTTTTATTTTGAGG - Intergenic
1003968559 6:11277190-11277212 CAGCTTCCATTTTAAGTGTAAGG - Intronic
1004049961 6:12067491-12067513 GAGCTTGGATTTTTTTTTTAAGG + Intronic
1005787049 6:29254649-29254671 CAGCTTCGATATTCTGATTATGG - Intergenic
1008362664 6:50639999-50640021 CAGCTTTGGTTATTCGTTAAAGG + Intergenic
1008822736 6:55653183-55653205 CAGCTTCTTTGTTTCTTTTATGG + Intergenic
1010815860 6:80357326-80357348 CAGCTGTGCTTTTTCCTTTATGG - Intergenic
1014326017 6:119994715-119994737 CATCTTCAATTTTTGGTATAGGG - Intergenic
1014776968 6:125522143-125522165 CAGCCTCGATATTTCATTTTTGG + Intergenic
1016899960 6:149091687-149091709 CAGCTTCATTCTTTCTTTTAAGG + Intergenic
1031097039 7:117432706-117432728 CAGTTTCGATTTTCTGTATATGG - Intergenic
1033603866 7:142910805-142910827 CAGCACCCATTTTTCATTTAGGG + Intronic
1037467943 8:19178222-19178244 CAACTTGGATTTTTCTTTAATGG - Intergenic
1041165882 8:55091678-55091700 CAGCTTCAATGTTTTTTTTAAGG - Intergenic
1043217452 8:77610396-77610418 CAGCTGCTATTTTTGTTTTATGG - Intergenic
1043235064 8:77854264-77854286 CAGCTTTGTTTTTTTGCTTATGG + Intergenic
1044914073 8:97093537-97093559 CAACTTTTATTTTTGGTTTAGGG - Intronic
1051099444 9:13504416-13504438 CAGCTTTGATTTTCTGTTTCTGG + Intergenic
1052719561 9:32156679-32156701 CAGCTTCAATCTTTGGCTTATGG + Intergenic
1055335604 9:75230156-75230178 CAGCCTCGATTGTTTGTGTAAGG + Intergenic
1057739114 9:97696833-97696855 CAGCTTCGATTTTTCGTTTAGGG - Intronic
1188346590 X:29074123-29074145 CAGTCTCGATTTTTCAGTTATGG + Intronic
1192293387 X:69821388-69821410 CAGCTTTTATTTTAAGTTTAGGG - Intronic
1193299508 X:79872752-79872774 CAGCTTCAATCTTTTGCTTATGG - Intergenic
1194096767 X:89650015-89650037 CAGCTTCAGGTTTTCCTTTATGG + Intergenic
1196218593 X:113085253-113085275 TAGCTTCAATTTTTTGTATATGG + Intergenic
1201246727 Y:12011862-12011884 CAGCTTTGTTTTTTGGCTTAGGG + Intergenic