ID: 1057739114

View in Genome Browser
Species Human (GRCh38)
Location 9:97696833-97696855
Sequence CAGCTTCGATTTTTCGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739114_1057739120 9 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739114_1057739116 -10 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739114_1057739122 11 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739122 9:97696867-97696889 GGTGCAGCGAAGAAGGCCCGGGG No data
1057739114_1057739128 26 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739114_1057739127 23 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739114_1057739126 18 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739126 9:97696874-97696896 CGAAGAAGGCCCGGGGCTGGGGG No data
1057739114_1057739124 16 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739124 9:97696872-97696894 AGCGAAGAAGGCCCGGGGCTGGG No data
1057739114_1057739125 17 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739125 9:97696873-97696895 GCGAAGAAGGCCCGGGGCTGGGG No data
1057739114_1057739123 15 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739114_1057739118 4 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739118 9:97696860-97696882 CAGCCGAGGTGCAGCGAAGAAGG No data
1057739114_1057739121 10 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG No data
Right 1057739121 9:97696866-97696888 AGGTGCAGCGAAGAAGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739114 Original CRISPR CAGCTTCGATTTTTCGTTTA GGG (reversed) Intronic