ID: 1057739115

View in Genome Browser
Species Human (GRCh38)
Location 9:97696834-97696856
Sequence GCAGCTTCGATTTTTCGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739115_1057739128 25 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739115_1057739118 3 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739118 9:97696860-97696882 CAGCCGAGGTGCAGCGAAGAAGG No data
1057739115_1057739124 15 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739124 9:97696872-97696894 AGCGAAGAAGGCCCGGGGCTGGG No data
1057739115_1057739121 9 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739121 9:97696866-97696888 AGGTGCAGCGAAGAAGGCCCGGG No data
1057739115_1057739123 14 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739115_1057739122 10 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739122 9:97696867-97696889 GGTGCAGCGAAGAAGGCCCGGGG No data
1057739115_1057739120 8 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739115_1057739126 17 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739126 9:97696874-97696896 CGAAGAAGGCCCGGGGCTGGGGG No data
1057739115_1057739127 22 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739115_1057739125 16 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739125 9:97696873-97696895 GCGAAGAAGGCCCGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739115 Original CRISPR GCAGCTTCGATTTTTCGTTT AGG (reversed) Intronic
902142977 1:14372044-14372066 TTAGCTTCAATTTTTCATTTTGG + Intergenic
914875052 1:151507150-151507172 GCAACTTCTATGTTTGGTTTTGG - Intergenic
919431333 1:197496115-197496137 GAAGCCTCAATTATTCGTTTTGG + Intergenic
924892823 1:248302933-248302955 GGATATTCGATTTTTGGTTTAGG + Intergenic
1064738257 10:18406158-18406180 GAAGCTTCCATTGTTTGTTTTGG + Intronic
1065058132 10:21868711-21868733 GGAGCTTCAAATTTTAGTTTTGG - Intronic
1065210211 10:23395727-23395749 GCCGCTTTGTTTTTTTGTTTGGG + Intergenic
1083485197 11:62979160-62979182 GCAGCTTCTAATTTGTGTTTTGG + Intronic
1087256771 11:95964718-95964740 GGAGCTTCGAATTTTATTTTTGG + Intergenic
1088681397 11:112245899-112245921 CCAGCTTTGTTTTTTGGTTTGGG - Intronic
1090723405 11:129498185-129498207 CCAGCTTTGTTTTTTCGCTTAGG - Intergenic
1091247404 11:134109921-134109943 TCAGCTTAGTTTTTTCCTTTTGG + Intronic
1092062193 12:5560422-5560444 TCAGCTTCATTTTTTCCTTTTGG - Intronic
1094375669 12:29784645-29784667 CCAGGTTCGAGTTTTGGTTTGGG + Intronic
1097151305 12:56981805-56981827 GGAGCTTCAATTCTTCTTTTAGG + Intergenic
1101180265 12:102209050-102209072 CCAGCTTTGTTTTTTTGTTTAGG - Intergenic
1105339072 13:19502845-19502867 GCAGCTTCTTTTTTTTTTTTTGG - Intronic
1106488530 13:30194342-30194364 GCAACTTCCATTTTTTGGTTCGG + Intergenic
1111913366 13:94336218-94336240 GCAGCCTGGATTTATCCTTTGGG - Intronic
1116013852 14:39382741-39382763 TCAGCTTCAGTTTTTCCTTTAGG + Intronic
1116209407 14:41914255-41914277 GAAGTTTAGATTTTTCATTTTGG + Intergenic
1120905502 14:89617785-89617807 GCAGGGTCGGTTTTTCATTTGGG - Intronic
1122588495 14:102827617-102827639 GCAGTTTGGATTTTTGGATTAGG + Intronic
1126696109 15:51327068-51327090 GCAGCTCGTATTTTTGGTTTCGG + Intronic
1134262183 16:12660349-12660371 ACAGATTGGATTTTTCCTTTAGG - Exonic
1134385577 16:13769214-13769236 GCAGATTCGATGCTTCCTTTTGG + Intergenic
1138943774 16:61822437-61822459 CCAGATTTGATTTTTCCTTTTGG - Intronic
1139170014 16:64618684-64618706 GCAGCATGGATTTTTTTTTTTGG - Intergenic
1139787695 16:69407229-69407251 GTAGCTCCAATTTTTCTTTTAGG - Intronic
1144238380 17:13284939-13284961 GGAGCTTAGATTTTTATTTTTGG + Intergenic
1144636848 17:16915605-16915627 GCAGCTCTGATTTTTTTTTTTGG - Intergenic
1145723436 17:27093290-27093312 GCACCTTCTATTTTTCTTTAAGG - Intergenic
1148461754 17:47843128-47843150 GCAGCTTCGATGTTTGCTTCTGG - Intergenic
1154131577 18:11741154-11741176 GCTTCTTTGATTTTTCCTTTTGG + Intronic
1155045141 18:22096675-22096697 CCAGTTTCCATTTTTCCTTTTGG - Intronic
1158164955 18:54529769-54529791 GCAGCTTAGAATTTTACTTTTGG + Intergenic
1159675583 18:71281396-71281418 GGGGCTTAGAATTTTCGTTTTGG - Intergenic
1159864556 18:73688798-73688820 TCAGCTTCATTTTTTCCTTTTGG + Intergenic
1163898752 19:20082078-20082100 GTAGCTTTTATTTTTGGTTTAGG + Intronic
1165596454 19:37014174-37014196 GCAGGAACGATTTTCCGTTTTGG - Intronic
1167565595 19:50254556-50254578 GCAGCTTCCACTTTTTCTTTTGG - Intronic
930163537 2:48181764-48181786 CCAGCTTTGTTTTTTCTTTTTGG - Intergenic
932264469 2:70355319-70355341 GCAGCATCCATATTTTGTTTTGG + Intergenic
932746435 2:74337412-74337434 GCAGTTTCCATTTTGGGTTTGGG - Intronic
933059089 2:77713346-77713368 GCAGCTTAGAATTTTATTTTTGG - Intergenic
935572951 2:104681093-104681115 GGGGCTTGGATTTTTAGTTTTGG - Intergenic
935713085 2:105916515-105916537 TCAGCTTAGTTTTTTCCTTTTGG + Intergenic
936648747 2:114402313-114402335 GCAGCTTCGATTAATACTTTTGG + Intergenic
940979555 2:159986158-159986180 GGAGCTTGGATTTTTGGATTTGG - Intronic
946062143 2:216952020-216952042 CCAGCTTTGTTTTTTTGTTTAGG + Intergenic
947111104 2:226720616-226720638 GGAGCCTCCATTTTTTGTTTTGG + Intergenic
948130757 2:235599113-235599135 GCTGCTTCTATTTTTCCTTGTGG + Intronic
948361341 2:237422683-237422705 GCATCTTCTATCTTTCCTTTTGG - Intronic
1171084752 20:22227287-22227309 GCAGCTTGGATTTTTTCTTTTGG + Intergenic
1171274668 20:23845964-23845986 TCATTTTCGACTTTTCGTTTTGG - Intergenic
1173660846 20:44732504-44732526 TCAGCTTAGTTTTTTCCTTTTGG + Intergenic
949628694 3:5897994-5898016 GCTGTTTGGATTTTTTGTTTTGG - Intergenic
959409675 3:106005268-106005290 GAAGCTTGGATTTTGCATTTGGG - Intergenic
961313797 3:126020537-126020559 GGAGCTTCGAATTTTGTTTTTGG - Intronic
963918398 3:150882197-150882219 GCAGCTTTGATTTGTGGTTTGGG + Intronic
964660918 3:159119396-159119418 GCATCTTTGATTTTAAGTTTTGG - Intronic
966257294 3:177931326-177931348 GCAGCTTAGCTGTGTCGTTTTGG - Intergenic
974789604 4:66670499-66670521 GCAGTTTCCATTTTTAATTTGGG + Intergenic
974942308 4:68484078-68484100 CCAGCTTTGTTTTTTTGTTTAGG + Intronic
975251253 4:72180790-72180812 GCAGCTTCATTTTCTCCTTTAGG + Intergenic
977126386 4:93173918-93173940 CCAGCCTGGATTTTTCTTTTAGG + Intronic
979057698 4:116016628-116016650 GTGGCTTTGATTTTTCCTTTTGG - Intergenic
987898044 5:23973868-23973890 GAACCTTGGATTTTTCTTTTGGG + Intronic
990730049 5:58798466-58798488 GAATCTTGGATTTTTGGTTTAGG - Intronic
992561214 5:77954720-77954742 ACAGCTTCTACTTTTTGTTTAGG - Intergenic
992780579 5:80123646-80123668 GCAGCTCCGCTTTTAAGTTTTGG - Intronic
995383259 5:111560469-111560491 TCAGCTTCAAATTTTCTTTTTGG + Intergenic
999617192 5:153436979-153437001 GCAGCTTCGATTATTCCTGAGGG + Intergenic
1008550353 6:52623888-52623910 GCATCTCCGATTATTTGTTTAGG - Intergenic
1012432382 6:99178257-99178279 GCAGCTTAGAATTTTATTTTTGG - Intergenic
1014326018 6:119994716-119994738 GCATCTTCAATTTTTGGTATAGG - Intergenic
1014483362 6:121966418-121966440 GCATCTGAGATTTTTTGTTTTGG + Intergenic
1018176094 6:161180649-161180671 GTAGCTTCGCTTTTGCATTTTGG - Intronic
1020521222 7:9189770-9189792 GCAGGCTGGATTTTTCCTTTTGG - Intergenic
1022030292 7:26486576-26486598 GCAGCTTCTTTTTTTTTTTTTGG + Intergenic
1023023661 7:36032676-36032698 GAAGCTTTGATTTTTCTTATGGG - Intergenic
1024093920 7:45969481-45969503 GGAGCTTGGATGTTTCTTTTTGG - Intergenic
1025969127 7:66305741-66305763 GCTGCTGCGAGTTTTCTTTTGGG + Intronic
1031430704 7:121665182-121665204 TCAGCTTAGTTTTTTCCTTTTGG - Intergenic
1034050989 7:147984363-147984385 GGTGCTTAGATTTTTAGTTTTGG + Intronic
1035430543 7:158817079-158817101 GGAGCTTAGAATTTTCTTTTTGG - Intronic
1040325707 8:46340491-46340513 GCAGCTTTGATTTCGCTTTTGGG - Intergenic
1048475541 8:134739226-134739248 GCTGCTTTGTTTTTTCTTTTGGG - Intergenic
1051991718 9:23160726-23160748 GCAGCTTCGTATGTTAGTTTTGG - Intergenic
1055797604 9:79992209-79992231 GCAGCTTCCATTTTGCCCTTTGG - Intergenic
1057461460 9:95266666-95266688 TCACCTTCTATTTTTCATTTTGG - Intronic
1057739115 9:97696834-97696856 GCAGCTTCGATTTTTCGTTTAGG - Intronic
1061256236 9:129455262-129455284 GCAGCTCCGATTTTCAGCTTGGG + Intergenic
1187119936 X:16395231-16395253 GCAGCTTTTATTTTTTGTTGTGG - Intergenic
1189137155 X:38561713-38561735 CCAGATTTGATTTTTGGTTTGGG - Intronic
1190010238 X:46778300-46778322 TCAGCTTCATTTTTTCCTTTTGG - Intergenic
1195398022 X:104432033-104432055 GCAGCTTGGACTTTTCTTTGAGG + Intergenic
1197402623 X:126010027-126010049 TCAGCTCTGATTTTTGGTTTTGG - Intergenic