ID: 1057739116

View in Genome Browser
Species Human (GRCh38)
Location 9:97696846-97696868
Sequence ATCGAAGCTGCCAGCAGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739104_1057739116 30 Left 1057739104 9:97696793-97696815 CCTGGCAGTGGCTGACACCTCCC 0: 1
1: 0
2: 6
3: 65
4: 363
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739114_1057739116 -10 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739113_1057739116 5 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739112_1057739116 9 Left 1057739112 9:97696814-97696836 CCGGCCGGGGCGGCTGCATCCCT 0: 1
1: 0
2: 2
3: 22
4: 177
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739110_1057739116 13 Left 1057739110 9:97696810-97696832 CCTCCCGGCCGGGGCGGCTGCAT 0: 1
1: 0
2: 7
3: 532
4: 6890
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data
1057739111_1057739116 10 Left 1057739111 9:97696813-97696835 CCCGGCCGGGGCGGCTGCATCCC 0: 1
1: 0
2: 0
3: 27
4: 308
Right 1057739116 9:97696846-97696868 ATCGAAGCTGCCAGCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739116 Original CRISPR ATCGAAGCTGCCAGCAGCCG AGG Intronic
No off target data available for this crispr