ID: 1057739117

View in Genome Browser
Species Human (GRCh38)
Location 9:97696856-97696878
Sequence CTTCGCTGCACCTCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739117_1057739131 20 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1057739117_1057739128 3 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739117_1057739126 -5 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739126 9:97696874-97696896 CGAAGAAGGCCCGGGGCTGGGGG No data
1057739117_1057739124 -7 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739124 9:97696872-97696894 AGCGAAGAAGGCCCGGGGCTGGG No data
1057739117_1057739127 0 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739117_1057739123 -8 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739117_1057739125 -6 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG No data
Right 1057739125 9:97696873-97696895 GCGAAGAAGGCCCGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739117 Original CRISPR CTTCGCTGCACCTCGGCTGC TGG (reversed) Intronic