ID: 1057739117

View in Genome Browser
Species Human (GRCh38)
Location 9:97696856-97696878
Sequence CTTCGCTGCACCTCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739117_1057739124 -7 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739124 9:97696872-97696894 AGCGAAGAAGGCCCGGGGCTGGG No data
1057739117_1057739126 -5 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739126 9:97696874-97696896 CGAAGAAGGCCCGGGGCTGGGGG No data
1057739117_1057739125 -6 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739125 9:97696873-97696895 GCGAAGAAGGCCCGGGGCTGGGG No data
1057739117_1057739127 0 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739117_1057739123 -8 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739117_1057739128 3 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739117_1057739131 20 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739117 Original CRISPR CTTCGCTGCACCTCGGCTGC TGG (reversed) Intronic
900344156 1:2203219-2203241 CTTGGCCCCACCTGGGCTGCAGG - Intronic
900480334 1:2895082-2895104 CCGCGCTGCTCCTCGGCTCCTGG + Intergenic
900627069 1:3613219-3613241 CTTCCCGGGATCTCGGCTGCAGG + Intergenic
900794709 1:4700928-4700950 CTTAGCTGAGCCTCTGCTGCTGG - Intronic
902478456 1:16700005-16700027 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
904462668 1:30689441-30689463 CTCGGGTGCACCTCGGGTGCAGG + Intergenic
908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG + Intronic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
915475057 1:156148343-156148365 CCTCTCTGCATCTCGGCTGTGGG - Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
920458096 1:206116410-206116432 CATCGCTGCTCCCTGGCTGCTGG - Exonic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
1066497972 10:35960708-35960730 CTTCGCTGACCCTCTGTTGCAGG - Intergenic
1070779720 10:79130433-79130455 CCTGGCTGCAGCTCTGCTGCAGG - Intronic
1073398250 10:103236162-103236184 CTTCCCTGCAGCTCTCCTGCCGG - Intergenic
1076121554 10:127940568-127940590 TGTTGCTGCACCTCTGCTGCTGG + Intronic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1078245875 11:9573315-9573337 CCTCGCTGCTCCTCCGGTGCTGG - Intergenic
1084597991 11:70128607-70128629 CTTCGCTCCAGGTCGCCTGCTGG - Intronic
1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG + Intronic
1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG + Intronic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1103614843 12:122145541-122145563 CTTACCTGCACCCCAGCTGCCGG - Exonic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1112472376 13:99700625-99700647 CTTCGGGGCCCCTCAGCTGCTGG - Intronic
1113542255 13:111118030-111118052 CTTCGCTTGACCTCTGCTGCAGG + Intronic
1114672135 14:24416974-24416996 CTTTGCTGCACCTGGCCTTCAGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120308195 14:82797267-82797289 CTTCGCTGCTCCTCTGTTTCTGG - Intergenic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG + Intergenic
1123632526 15:22271996-22272018 CTTCACTGCACCCCGACTCCCGG + Intergenic
1126794103 15:52245727-52245749 CATCACTGCATCTCGGCTGCTGG - Intronic
1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG + Intronic
1127632830 15:60842299-60842321 CTTGGCTGCCCATGGGCTGCAGG + Intronic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1129448351 15:75634563-75634585 CCTCTCTGCCCCTCTGCTGCTGG + Intergenic
1130460183 15:84154495-84154517 CCTCTCTGAGCCTCGGCTGCTGG + Intergenic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG + Intergenic
1135905991 16:26512195-26512217 CTTGGCTGCACCCAGGATGCTGG - Intergenic
1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG + Intronic
1141460949 16:84178630-84178652 CTCCGCTGCGCCTCAGCTGTGGG - Exonic
1141805631 16:86339585-86339607 CTTTGCTGCAACACGGGTGCAGG - Intergenic
1144584454 17:16479680-16479702 TTTCGCTACAGCTCTGCTGCTGG - Intronic
1145943847 17:28758821-28758843 CCTCGCTGCACATCTGCTGTAGG + Exonic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1151365168 17:73612272-73612294 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365206 17:73612399-73612421 CCCAGCTGCACCTAGGCTGCAGG + Intronic
1152252354 17:79218656-79218678 CCTCCCTGCATCTCGGCTCCCGG - Intronic
1152627421 17:81393948-81393970 CTCCGCCGCACCTCGGCTCCCGG + Intergenic
1153688090 18:7566839-7566861 CTGCGCTGCTCGGCGGCTGCGGG - Exonic
1158393348 18:57061285-57061307 CTTCGCTGCACCTTGCCACCTGG - Intergenic
1202712475 1_KI270714v1_random:25836-25858 CGTCGCAGGAGCTCGGCTGCGGG + Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
930234244 2:48873720-48873742 CTTCACTGCAGCCCAGCTGCTGG - Intergenic
935713104 2:105916670-105916692 CTCCACTGCTCCTCTGCTGCGGG + Intergenic
938293251 2:130161470-130161492 CTGCGCTGGCCCGCGGCTGCTGG - Intronic
938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG + Intergenic
1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG + Intronic
1174055328 20:47794615-47794637 CTTTCATGCACCTCGGCAGCCGG - Intergenic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181475351 22:23164652-23164674 CATTGCCGCACCTTGGCTGCAGG - Intergenic
1182477056 22:30582081-30582103 CTTTGCTGCATGTCTGCTGCTGG + Intronic
1182688193 22:32136914-32136936 CTTTCCTGCACCACAGCTGCAGG - Intergenic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1184264224 22:43338293-43338315 CTGCCCTGCACCTGGGGTGCTGG - Intronic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1185266925 22:49909129-49909151 CTTCTCTGCAGCGTGGCTGCAGG - Intronic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG + Intergenic
963252970 3:143119620-143119642 CGTCGCTGCGCCTCGGGGGCTGG - Exonic
963545130 3:146647522-146647544 CATCCCAGCACCTTGGCTGCTGG + Intergenic
967336072 3:188346051-188346073 CTTGGCTGCACATTCGCTGCAGG - Intronic
973832854 4:54779377-54779399 TTTCTCTGCACCTCAGCTGATGG - Intergenic
981042663 4:140237762-140237784 CCTGGCTGCACATTGGCTGCTGG - Intergenic
981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG + Intergenic
981963970 4:150579656-150579678 CTCCGCTGCACCTCCACTGGCGG - Intronic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
983040007 4:162914336-162914358 CTTCCCTGTACCACAGCTGCAGG - Intergenic
985199943 4:187474470-187474492 CTTCACTGCACCCTGGCTGTCGG + Intergenic
995154761 5:108897713-108897735 CTTCAGTGCATCTCAGCTGCTGG - Exonic
1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG + Intergenic
1006183960 6:32169959-32169981 CGTCGCTTCACCTCGGGTGAGGG - Exonic
1010303571 6:74289516-74289538 CCTGGCTGCACCTCTGCTGGGGG + Intergenic
1012211376 6:96522158-96522180 TTTCGCTGCAGCTGGGCTGGGGG - Intronic
1016356748 6:143226901-143226923 CTGGGCTGCATGTCGGCTGCGGG - Intronic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1019135794 6:169906883-169906905 CTTCCCTGCACATCCTCTGCGGG - Intergenic
1019667173 7:2257706-2257728 CTTGGCTGCTCCTTGGCTGGGGG - Intronic
1022806160 7:33824508-33824530 CATAGCTCCACCTAGGCTGCAGG - Intergenic
1030093379 7:105876842-105876864 CGCCGCTGCATCCCGGCTGCCGG - Intronic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1042455544 8:68998327-68998349 CTTCTCTGCTCCTAGGCTGAAGG + Intergenic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1053576153 9:39358434-39358456 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1053840670 9:42186371-42186393 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG + Intergenic
1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054588626 9:66989807-66989829 CTTCACTGCTCCTCCCCTGCGGG - Intergenic
1057433288 9:95015630-95015652 CTTCCCTGCACCTCTGATACAGG - Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058237805 9:102514735-102514757 CTTGGCTGCAGCCCAGCTGCAGG - Intergenic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1062213936 9:135378921-135378943 CTTCACTGCTGCTCGGCTCCTGG - Intergenic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic