ID: 1057739119

View in Genome Browser
Species Human (GRCh38)
Location 9:97696863-97696885
Sequence GGGCCTTCTTCGCTGCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739119_1057739128 -4 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739119_1057739127 -7 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data
1057739119_1057739134 25 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1057739134 9:97696911-97696933 TGCGACAGAGGAACGCTCTGTGG 0: 1
1: 0
2: 3
3: 13
4: 364
1057739119_1057739131 13 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739119 Original CRISPR GGGCCTTCTTCGCTGCACCT CGG (reversed) Intronic
902816957 1:18922058-18922080 GGGCCTTGCTTTCTGCACCTGGG - Intronic
905394385 1:37657710-37657732 TGGCCTTCTTCCCTGTAGCTTGG - Intergenic
916143978 1:161723709-161723731 GGCCCTTGTTTCCTGCACCTTGG - Intronic
919733311 1:200928459-200928481 GGCCCTGCTTCTCTGCACATGGG + Intergenic
919807061 1:201386425-201386447 GGCCCTTCCTCTCTGCTCCTTGG + Exonic
924083083 1:240419977-240419999 AGGCCTCCTTGGCTGCCCCTTGG + Intronic
924268200 1:242304287-242304309 GGGCCCTCTTCACTGCAGATTGG + Intronic
1063003509 10:1946491-1946513 CTGGCTTCTGCGCTGCACCTGGG - Intergenic
1064474803 10:15676190-15676212 GGTCCCTCTTCTCTTCACCTAGG + Intronic
1066283278 10:33939194-33939216 TGGCCTTCCTCACTGCACATTGG + Intergenic
1066716706 10:38294459-38294481 GGGCCCTCTTCACTGCAGATTGG - Intergenic
1067737465 10:48869288-48869310 GGGCCTCATTTGGTGCACCTGGG - Intronic
1072527430 10:96285791-96285813 GAGCCTTCTTGGCGTCACCTAGG - Intergenic
1076329356 10:129653505-129653527 GGGCCATCTCTGCAGCACCTCGG - Intronic
1077114321 11:876435-876457 GGGCCGTGTTCGCAGCTCCTTGG - Intronic
1090430560 11:126642612-126642634 GGGACTTCTTCTTTGCTCCTTGG - Intronic
1091216881 11:133907568-133907590 GGGCCTTCTGCCCTGCCCTTGGG + Intergenic
1102713839 12:114952796-114952818 GGGCCTTCTCTGCTGCAAGTGGG - Intergenic
1113654323 13:112058437-112058459 CGGCCTCCTCCCCTGCACCTAGG + Intergenic
1116964056 14:50996630-50996652 GGGCCTTCTGCGTTGCATCTAGG + Intronic
1122552416 14:102557142-102557164 GGACCTTGTCCGCTGCAGCTGGG + Intergenic
1123114992 14:105890546-105890568 GGGCCTTCTTGGGGCCACCTCGG + Intergenic
1128092542 15:64928756-64928778 GGGCCCTCTCCCCTCCACCTTGG - Intronic
1128666552 15:69542432-69542454 GGGCCTTCTTGTCTGCAGGTGGG - Intergenic
1129233490 15:74209547-74209569 GGGCCTTTTTCACTTCCCCTGGG - Intronic
1130048991 15:80467774-80467796 AGGCCTTTCTTGCTGCACCTTGG + Intronic
1138563756 16:57817524-57817546 GGGCGATCTTCAGTGCACCTCGG + Intronic
1141425531 16:83942259-83942281 GGCCCTTCTTTGCTTTACCTTGG - Intronic
1157576304 18:48746155-48746177 GGGCCATCTTTGCTTCACGTAGG + Intronic
1159945125 18:74438966-74438988 GGGCCTTATTCCCTGCTGCTGGG - Intronic
1163692466 19:18745152-18745174 GGGGCTTCCTCCCAGCACCTGGG - Intronic
1168667751 19:58217385-58217407 GGGCCATTTTGGCTACACCTGGG + Intergenic
925393952 2:3519143-3519165 GGGCCTCCTGCGCGGCGCCTGGG - Intronic
926735509 2:16070597-16070619 AGGCCTTCTTGGCTGTTCCTCGG + Intergenic
930772372 2:55141123-55141145 TGGCCATCTTTGCTGTACCTTGG + Intergenic
932123025 2:69118741-69118763 AAGCCTTCCTTGCTGCACCTCGG - Intronic
937238676 2:120446429-120446451 TGGCCTTACTCGCTGCAGCTGGG - Intergenic
938364658 2:130725652-130725674 GGGCCCTCATCATTGCACCTGGG - Intergenic
940020960 2:149155468-149155490 GGGCCTTGTTTGCTGCCCCAGGG + Intronic
945189000 2:207166812-207166834 GGCGCTTCTTCTCTGCACCCTGG - Intronic
945235852 2:207630685-207630707 AGCCCTTCCTGGCTGCACCTGGG + Intergenic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1180175450 21:46084970-46084992 GGGGACTCTTCACTGCACCTGGG - Intergenic
1180707113 22:17816855-17816877 CGGCCTCCTTGGCTGCACATGGG - Intronic
1180859463 22:19069028-19069050 GGGCCCTCTCCCCTGCACCATGG - Intronic
1184430546 22:44439574-44439596 GAGCCTTCAGCCCTGCACCTCGG - Intergenic
953753451 3:45627165-45627187 GCTCCTTCTTGGCTGCAGCTAGG - Intronic
962361116 3:134743565-134743587 GGGCCTACTTCACTGGACCAAGG + Intronic
966835149 3:184044028-184044050 GGGCCTCCTGAGCCGCACCTAGG - Intergenic
969963341 4:10969520-10969542 GGGGCATCTTCAGTGCACCTGGG - Intergenic
970078370 4:12251318-12251340 AGGCCTTATTCCTTGCACCTGGG + Intergenic
975887476 4:78982569-78982591 TGGCCATCTTGGCTCCACCTCGG + Intergenic
982052000 4:151511294-151511316 CGGCCATCTTGGCTCCACCTCGG - Intronic
985891854 5:2722018-2722040 CAGCCTTCCTCCCTGCACCTTGG + Intergenic
986445005 5:7813816-7813838 GGAGCTTGTTTGCTGCACCTTGG + Intronic
988786614 5:34571032-34571054 GCTCCTTCTTCCCTGCCCCTTGG + Intergenic
990530514 5:56669159-56669181 GTCCCTTCTTCCTTGCACCTAGG + Intergenic
993116121 5:83722119-83722141 GGGCCCTGCTCGCTGCAACTCGG - Intergenic
995760003 5:115552629-115552651 TGGCATTATTCTCTGCACCTAGG + Intergenic
996291798 5:121860265-121860287 GGGTCTGGTTCGCTCCACCTTGG - Intergenic
1004870926 6:19903102-19903124 GGTCCTTATTCCCTGCACCTGGG - Intergenic
1018730529 6:166646650-166646672 GGACCTTCTTCGTTTCACCAGGG + Intronic
1019274731 7:170015-170037 GGCCCTGCTTCCCTGCACCACGG + Intergenic
1019488018 7:1298346-1298368 GGACCTTGTTCTCTGCTCCTTGG + Intergenic
1022654672 7:32307743-32307765 CGGCCATCTTGGCTCCACCTCGG - Intergenic
1024564709 7:50671990-50672012 GGTCCTTCTTCTCTGTGCCTTGG + Intronic
1026803999 7:73418251-73418273 CTTCCTTCTTCCCTGCACCTGGG - Intergenic
1028024497 7:85820888-85820910 GGGCCTCCTGCTCTGGACCTAGG + Intergenic
1028650435 7:93144786-93144808 GGGCCTGCTGGGCTGCAGCTGGG - Exonic
1032194019 7:129779665-129779687 GGGACTTCTGCCCTGCACCCGGG + Intergenic
1037744365 8:21631061-21631083 GGGCCTTCTTCTCAGCAGCCTGG + Intergenic
1045046304 8:98282195-98282217 GCCCCTTGTTTGCTGCACCTTGG - Intronic
1049751920 8:144288957-144288979 GTCCCTCCTTCACTGCACCTGGG - Intronic
1056568956 9:87799200-87799222 GGTCCCTCTTCGCTCCCCCTGGG - Intergenic
1057739119 9:97696863-97696885 GGGCCTTCTTCGCTGCACCTCGG - Intronic
1057797413 9:98168958-98168980 GGGCCTTCTGGCCTCCACCTAGG - Intronic
1062360972 9:136187899-136187921 GGGCCATGTTGGCAGCACCTGGG - Intergenic
1194284552 X:91993791-91993813 GGGTCTTCTTCCCTTCTCCTTGG + Intronic
1197639114 X:128948693-128948715 GGGGCTTCTTGGCTGCATGTTGG - Intergenic
1199300240 X:146204849-146204871 GGGACCTCTCCGCTGAACCTTGG + Intergenic