ID: 1057739119

View in Genome Browser
Species Human (GRCh38)
Location 9:97696863-97696885
Sequence GGGCCTTCTTCGCTGCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739119_1057739128 -4 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC No data
Right 1057739128 9:97696882-97696904 GCCCGGGGCTGGGGGTCAGGAGG No data
1057739119_1057739131 13 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC No data
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1057739119_1057739134 25 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC No data
Right 1057739134 9:97696911-97696933 TGCGACAGAGGAACGCTCTGTGG 0: 1
1: 0
2: 3
3: 13
4: 364
1057739119_1057739127 -7 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC No data
Right 1057739127 9:97696879-97696901 AAGGCCCGGGGCTGGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739119 Original CRISPR GGGCCTTCTTCGCTGCACCT CGG (reversed) Intronic