ID: 1057739120

View in Genome Browser
Species Human (GRCh38)
Location 9:97696865-97696887
Sequence GAGGTGCAGCGAAGAAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739115_1057739120 8 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739113_1057739120 24 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739112_1057739120 28 Left 1057739112 9:97696814-97696836 CCGGCCGGGGCGGCTGCATCCCT 0: 1
1: 0
2: 2
3: 22
4: 177
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739114_1057739120 9 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data
1057739111_1057739120 29 Left 1057739111 9:97696813-97696835 CCCGGCCGGGGCGGCTGCATCCC 0: 1
1: 0
2: 0
3: 27
4: 308
Right 1057739120 9:97696865-97696887 GAGGTGCAGCGAAGAAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739120 Original CRISPR GAGGTGCAGCGAAGAAGGCC CGG Intronic
No off target data available for this crispr