ID: 1057739123

View in Genome Browser
Species Human (GRCh38)
Location 9:97696871-97696893
Sequence CAGCGAAGAAGGCCCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739117_1057739123 -8 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739114_1057739123 15 Left 1057739114 9:97696833-97696855 CCCTAAACGAAAAATCGAAGCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739113_1057739123 30 Left 1057739113 9:97696818-97696840 CCGGGGCGGCTGCATCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data
1057739115_1057739123 14 Left 1057739115 9:97696834-97696856 CCTAAACGAAAAATCGAAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739123 Original CRISPR CAGCGAAGAAGGCCCGGGGC TGG Intronic
No off target data available for this crispr