ID: 1057739131

View in Genome Browser
Species Human (GRCh38)
Location 9:97696899-97696921
Sequence AGGAGGCCCGCGTGCGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057739117_1057739131 20 Left 1057739117 9:97696856-97696878 CCAGCAGCCGAGGTGCAGCGAAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1057739119_1057739131 13 Left 1057739119 9:97696863-97696885 CCGAGGTGCAGCGAAGAAGGCCC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1057739130_1057739131 -8 Left 1057739130 9:97696884-97696906 CCGGGGCTGGGGGTCAGGAGGCC 0: 1
1: 2
2: 22
3: 111
4: 709
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1057739129_1057739131 -7 Left 1057739129 9:97696883-97696905 CCCGGGGCTGGGGGTCAGGAGGC 0: 1
1: 2
2: 14
3: 140
4: 942
Right 1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057739131 Original CRISPR AGGAGGCCCGCGTGCGACAG AGG Intronic
906116093 1:43358475-43358497 AGGAGAGCCGCGGGCGGCAGCGG - Intergenic
913271435 1:117097475-117097497 AGGAGGCCAGTGGGCTACAGGGG + Intronic
914086773 1:144461203-144461225 AGGAGGGCTGCGGGCGGCAGCGG + Intronic
920371337 1:205481179-205481201 AGGAGGCCCTGGTGCCACACAGG - Intergenic
921947383 1:220895449-220895471 AGGCGTCCCGCAGGCGACAGTGG + Intergenic
1065390080 10:25174581-25174603 AGGCGGCCCGCGGGCGGCGGGGG - Intergenic
1067405954 10:46023549-46023571 AGGGGGGCCGCGAGCGCCAGCGG - Intronic
1071266218 10:83967282-83967304 AGGAGGCCCAGGTACTACAGGGG - Intergenic
1076335118 10:129701773-129701795 AGGAAGCCCGTGTCCAACAGGGG + Intronic
1077495907 11:2886297-2886319 AGGAGGCCCACGGGCGAGCGCGG - Intergenic
1079030745 11:16984605-16984627 AGGAGGCCTGGGTGTGAGAGTGG - Intronic
1081502658 11:43681322-43681344 AGGAGGACAGCGTGTGACTGAGG - Intronic
1091360839 11:134977533-134977555 AGGAGGCCCAGGTGGGACTGAGG - Intergenic
1091434594 12:462439-462461 AGGCGGCCCACGGGAGACAGAGG - Intronic
1096208363 12:49742147-49742169 AGGAGCCTCGCGTGTCACAGAGG - Exonic
1098301133 12:69055238-69055260 AGGAGGCCGGGGTGGGGCAGGGG - Intergenic
1104387833 12:128366181-128366203 AGGAGAGCCGCGGGCGACACAGG - Intronic
1113914717 13:113863521-113863543 TGGAGGCGCGCGGGCGCCAGGGG + Intronic
1114325704 14:21586864-21586886 AGGAGGCCACAGTGGGACAGGGG - Intergenic
1117674060 14:58138275-58138297 AGGAGGCCAGCCTTGGACAGAGG - Exonic
1118812910 14:69288463-69288485 AGGAGGCCCATGTGAAACAGCGG + Intronic
1119170260 14:72529532-72529554 AGGAGGCCCATGTGGGTCAGAGG - Intronic
1121432578 14:93898363-93898385 AGGAGGCTAGGGAGCGACAGGGG + Intergenic
1133009132 16:2900643-2900665 AGGAGGCCGGGGTGGGTCAGAGG + Intergenic
1138525870 16:57606993-57607015 GAGAGGCCCGCGTGGGCCAGGGG - Intergenic
1142470463 17:160654-160676 AGGAGTCCCCCGTGCCACTGGGG - Intronic
1142583074 17:953664-953686 AGGAGTCCAGAGTGAGACAGAGG + Intronic
1144686255 17:17228155-17228177 AACAGGCCTGCGTGGGACAGGGG + Exonic
1145938106 17:28726667-28726689 CGGAGCCCCGCGTCCGACAGTGG + Intronic
1149580241 17:57744973-57744995 AGGCGGCTCGCGTGAGGCAGCGG - Exonic
1150221296 17:63497203-63497225 AGCAGGCCCGCGTGGGCCAGTGG + Intronic
1150675904 17:67245614-67245636 AGGAAGCCCGCGAGCGGCCGGGG + Intronic
1152090158 17:78241973-78241995 AAGAGGCCCACGTGGGCCAGTGG - Intergenic
1154494465 18:14945424-14945446 AGGAGGCCCAGGTGGGACTGAGG + Intergenic
1161816316 19:6502022-6502044 AGGAGGCCAGCGCGCCCCAGGGG - Intronic
1163557507 19:18001094-18001116 CGGCGGCCCGCGTGCGTCACGGG + Intergenic
1165493681 19:36140102-36140124 GGGAGGCCCGGGAGCGGCAGTGG + Exonic
925609502 2:5691988-5692010 GGGAGGCCCGACGGCGACAGCGG - Intergenic
933950653 2:87326617-87326639 AGGAGGCACAGGTGCTACAGAGG + Intergenic
934527803 2:95062382-95062404 AGGAGGCCCGAGTCTGGCAGTGG - Intergenic
934845358 2:97658675-97658697 AGGAGGTCCCCGTGCCTCAGTGG - Intronic
936329125 2:111531962-111531984 AGGAGGCACAGGTGCTACAGAGG - Intergenic
941951327 2:171160251-171160273 AGGAGGCCCGCGAGCGGGCGCGG + Intronic
948903585 2:240967733-240967755 AGGAGGCCAGGGTGGGGCAGGGG - Intronic
1172044866 20:32073180-32073202 AGGAGGCCCACATACGGCAGGGG - Intronic
1175424177 20:58853823-58853845 AGGAGGCCCAGGTGCTGCAGGGG + Exonic
1179965366 21:44801780-44801802 AGGAGGCACGCGCGCGGCTGAGG - Exonic
1185248172 22:49784512-49784534 AGCCGGCCCGCGGGCGACACGGG + Intronic
949467821 3:4361842-4361864 AGGAGGCCCGCGTCCTACGCAGG - Exonic
950477106 3:13221405-13221427 AGGAGGCCTCTGTGTGACAGAGG - Intergenic
968741032 4:2331865-2331887 AGGAGGCCTGCCTGGGGCAGAGG - Intronic
980234686 4:130090439-130090461 AGGAGGCACGAGAGCGAGAGAGG - Intergenic
981068374 4:140508714-140508736 AGGAGGCCTGCGTGCCCCTGTGG + Intergenic
984923734 4:184788101-184788123 AGGAGGCCTGGGAGGGACAGAGG + Intronic
1001088386 5:168718423-168718445 AGGTGGCCCTCCTGCGACTGGGG + Intronic
1001329448 5:170752041-170752063 AGGAGGCCCACATTCCACAGAGG + Intergenic
1006582837 6:35086682-35086704 AGGAGGCCCGCCTAGGACAGGGG + Intronic
1017447784 6:154524050-154524072 AGGAAGCCAGCGTGTGACATGGG + Intergenic
1018046676 6:159971357-159971379 AGTATGCCCACGTGTGACAGTGG - Intronic
1026575008 7:71564692-71564714 ATGAGGCCCGCCTGGGACACAGG + Intronic
1032094971 7:128933433-128933455 TGGAGGCCCGCGGGGGACAGGGG + Intergenic
1045441883 8:102221960-102221982 AGGAGGCCCAGGTGGGACTGAGG - Intronic
1049405381 8:142449902-142449924 AGGGGGCCTGCGTGCGCCGGCGG + Exonic
1057739131 9:97696899-97696921 AGGAGGCCCGCGTGCGACAGAGG + Intronic
1060010848 9:120041673-120041695 AGGAGGCCAGAGTGTGGCAGGGG - Intergenic
1061187524 9:129063436-129063458 AGGTGGCCCACCTGCCACAGAGG - Intronic
1061371181 9:130198383-130198405 GTGAGGCCCGCCTGAGACAGTGG + Intronic
1061587177 9:131576666-131576688 AGGAGCCCCGCCTGCGACAGGGG + Intergenic
1061959255 9:133979680-133979702 AGGAGGTCCTCGTGGGCCAGAGG - Intronic
1197728044 X:129789210-129789232 AGGAGGCGGGCCTGGGACAGGGG + Intronic
1199701061 X:150375965-150375987 AGGAGTCCCTGGTGCTACAGTGG + Intronic