ID: 1057740186

View in Genome Browser
Species Human (GRCh38)
Location 9:97704480-97704502
Sequence TACTACATGAATGCAGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057740186_1057740189 12 Left 1057740186 9:97704480-97704502 CCTTAAGCTGCATTCATGTAGTA No data
Right 1057740189 9:97704515-97704537 CAGTCTCTTTTTTCTGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057740186 Original CRISPR TACTACATGAATGCAGCTTA AGG (reversed) Intergenic
No off target data available for this crispr