ID: 1057742252

View in Genome Browser
Species Human (GRCh38)
Location 9:97722039-97722061
Sequence TGGGTTACAAGGTAAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057742248_1057742252 -3 Left 1057742248 9:97722019-97722041 CCTATCTCAGAGTCATCATGTGG No data
Right 1057742252 9:97722039-97722061 TGGGTTACAAGGTAAGAATCAGG No data
1057742247_1057742252 -2 Left 1057742247 9:97722018-97722040 CCCTATCTCAGAGTCATCATGTG No data
Right 1057742252 9:97722039-97722061 TGGGTTACAAGGTAAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057742252 Original CRISPR TGGGTTACAAGGTAAGAATC AGG Intergenic
No off target data available for this crispr