ID: 1057743784

View in Genome Browser
Species Human (GRCh38)
Location 9:97735283-97735305
Sequence CTGTGGGAGGGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057743776_1057743784 -8 Left 1057743776 9:97735268-97735290 CCAGGCAGTTCCACCCTGTGGGA No data
Right 1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057743784 Original CRISPR CTGTGGGAGGGGAGAGAAGA GGG Intergenic
No off target data available for this crispr