ID: 1057744080

View in Genome Browser
Species Human (GRCh38)
Location 9:97737711-97737733
Sequence CCCCACCCTCTGTTCCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744080_1057744086 16 Left 1057744080 9:97737711-97737733 CCCGGCAGGAACAGAGGGTGGGG No data
Right 1057744086 9:97737750-97737772 TCCTCAGGAAGTCTGTATGTGGG No data
1057744080_1057744088 25 Left 1057744080 9:97737711-97737733 CCCGGCAGGAACAGAGGGTGGGG No data
Right 1057744088 9:97737759-97737781 AGTCTGTATGTGGGTGCGTTAGG No data
1057744080_1057744085 15 Left 1057744080 9:97737711-97737733 CCCGGCAGGAACAGAGGGTGGGG No data
Right 1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG No data
1057744080_1057744084 1 Left 1057744080 9:97737711-97737733 CCCGGCAGGAACAGAGGGTGGGG No data
Right 1057744084 9:97737735-97737757 TGCTGCAGGAATTTCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744080 Original CRISPR CCCCACCCTCTGTTCCTGCC GGG (reversed) Intergenic
No off target data available for this crispr