ID: 1057744082

View in Genome Browser
Species Human (GRCh38)
Location 9:97737712-97737734
Sequence TCCCCACCCTCTGTTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744082_1057744088 24 Left 1057744082 9:97737712-97737734 CCGGCAGGAACAGAGGGTGGGGA No data
Right 1057744088 9:97737759-97737781 AGTCTGTATGTGGGTGCGTTAGG No data
1057744082_1057744085 14 Left 1057744082 9:97737712-97737734 CCGGCAGGAACAGAGGGTGGGGA No data
Right 1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG No data
1057744082_1057744086 15 Left 1057744082 9:97737712-97737734 CCGGCAGGAACAGAGGGTGGGGA No data
Right 1057744086 9:97737750-97737772 TCCTCAGGAAGTCTGTATGTGGG No data
1057744082_1057744084 0 Left 1057744082 9:97737712-97737734 CCGGCAGGAACAGAGGGTGGGGA No data
Right 1057744084 9:97737735-97737757 TGCTGCAGGAATTTCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744082 Original CRISPR TCCCCACCCTCTGTTCCTGC CGG (reversed) Intergenic
No off target data available for this crispr