ID: 1057744085

View in Genome Browser
Species Human (GRCh38)
Location 9:97737749-97737771
Sequence CTCCTCAGGAAGTCTGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744082_1057744085 14 Left 1057744082 9:97737712-97737734 CCGGCAGGAACAGAGGGTGGGGA No data
Right 1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG No data
1057744080_1057744085 15 Left 1057744080 9:97737711-97737733 CCCGGCAGGAACAGAGGGTGGGG No data
Right 1057744085 9:97737749-97737771 CTCCTCAGGAAGTCTGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744085 Original CRISPR CTCCTCAGGAAGTCTGTATG TGG Intergenic
No off target data available for this crispr