ID: 1057744104

View in Genome Browser
Species Human (GRCh38)
Location 9:97737937-97737959
Sequence CTGCAAACAGCAGCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744104_1057744107 3 Left 1057744104 9:97737937-97737959 CCATCCTCAGCTGCTGTTTGCAG No data
Right 1057744107 9:97737963-97737985 TTAGGCAGCGTTCCCAGCAGAGG No data
1057744104_1057744108 12 Left 1057744104 9:97737937-97737959 CCATCCTCAGCTGCTGTTTGCAG No data
Right 1057744108 9:97737972-97737994 GTTCCCAGCAGAGGAAGCCCAGG No data
1057744104_1057744111 20 Left 1057744104 9:97737937-97737959 CCATCCTCAGCTGCTGTTTGCAG No data
Right 1057744111 9:97737980-97738002 CAGAGGAAGCCCAGGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744104 Original CRISPR CTGCAAACAGCAGCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr