ID: 1057744885

View in Genome Browser
Species Human (GRCh38)
Location 9:97742932-97742954
Sequence CTGCTTACAGAGATGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744885_1057744888 9 Left 1057744885 9:97742932-97742954 CCTTGCTGCATCTCTGTAAGCAG No data
Right 1057744888 9:97742964-97742986 TTCATGTAACTTGTTGTGTGTGG No data
1057744885_1057744889 10 Left 1057744885 9:97742932-97742954 CCTTGCTGCATCTCTGTAAGCAG No data
Right 1057744889 9:97742965-97742987 TCATGTAACTTGTTGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744885 Original CRISPR CTGCTTACAGAGATGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr