ID: 1057744889

View in Genome Browser
Species Human (GRCh38)
Location 9:97742965-97742987
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057744885_1057744889 10 Left 1057744885 9:97742932-97742954 CCTTGCTGCATCTCTGTAAGCAG No data
Right 1057744889 9:97742965-97742987 TCATGTAACTTGTTGTGTGTGGG No data
1057744883_1057744889 27 Left 1057744883 9:97742915-97742937 CCTACGCTTCTACAGTCCCTTGC No data
Right 1057744889 9:97742965-97742987 TCATGTAACTTGTTGTGTGTGGG No data
1057744884_1057744889 11 Left 1057744884 9:97742931-97742953 CCCTTGCTGCATCTCTGTAAGCA No data
Right 1057744889 9:97742965-97742987 TCATGTAACTTGTTGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057744889 Original CRISPR TCATGTAACTTGTTGTGTGT GGG Intergenic
No off target data available for this crispr