ID: 1057745074

View in Genome Browser
Species Human (GRCh38)
Location 9:97745000-97745022
Sequence CTGTTTGAACATATGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057745074_1057745079 28 Left 1057745074 9:97745000-97745022 CCATCCTACATATGTTCAAACAG No data
Right 1057745079 9:97745051-97745073 TTTTACAGATGCGAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057745074 Original CRISPR CTGTTTGAACATATGTAGGA TGG (reversed) Intergenic
No off target data available for this crispr