ID: 1057745133

View in Genome Browser
Species Human (GRCh38)
Location 9:97745363-97745385
Sequence CTAAAGGACCAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057745133_1057745143 28 Left 1057745133 9:97745363-97745385 CCATGCTCCATCTGGTCCTTTAG No data
Right 1057745143 9:97745414-97745436 GGCCTAAAGGAGAGGAGTTGAGG No data
1057745133_1057745141 15 Left 1057745133 9:97745363-97745385 CCATGCTCCATCTGGTCCTTTAG No data
Right 1057745141 9:97745401-97745423 ATCTGAGAACAGTGGCCTAAAGG No data
1057745133_1057745139 7 Left 1057745133 9:97745363-97745385 CCATGCTCCATCTGGTCCTTTAG No data
Right 1057745139 9:97745393-97745415 CCCAAGCTATCTGAGAACAGTGG No data
1057745133_1057745142 20 Left 1057745133 9:97745363-97745385 CCATGCTCCATCTGGTCCTTTAG No data
Right 1057745142 9:97745406-97745428 AGAACAGTGGCCTAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057745133 Original CRISPR CTAAAGGACCAGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr