ID: 1057746080

View in Genome Browser
Species Human (GRCh38)
Location 9:97752418-97752440
Sequence CTGTTTCAGGAGCAGCAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057746080_1057746085 13 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746085 9:97752454-97752476 TTGAGAGTGAGCAGGGAAGAGGG No data
1057746080_1057746087 25 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746087 9:97752466-97752488 AGGGAAGAGGGCACCTGGACAGG No data
1057746080_1057746083 6 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746083 9:97752447-97752469 TGTCTTCTTGAGAGTGAGCAGGG No data
1057746080_1057746084 12 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746084 9:97752453-97752475 CTTGAGAGTGAGCAGGGAAGAGG No data
1057746080_1057746086 20 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746086 9:97752461-97752483 TGAGCAGGGAAGAGGGCACCTGG No data
1057746080_1057746082 5 Left 1057746080 9:97752418-97752440 CCGCACTGCTGCTCCTGAAACAG No data
Right 1057746082 9:97752446-97752468 CTGTCTTCTTGAGAGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057746080 Original CRISPR CTGTTTCAGGAGCAGCAGTG CGG (reversed) Intergenic
No off target data available for this crispr