ID: 1057747174

View in Genome Browser
Species Human (GRCh38)
Location 9:97761600-97761622
Sequence TCCCAAGTGCTTCACTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747174_1057747179 14 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747179 9:97761637-97761659 GCTCGGACTTGAGGGCAGTCAGG No data
1057747174_1057747177 5 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747177 9:97761628-97761650 TTCAGTGGTGCTCGGACTTGAGG No data
1057747174_1057747178 6 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747178 9:97761629-97761651 TCAGTGGTGCTCGGACTTGAGGG No data
1057747174_1057747175 -10 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747175 9:97761613-97761635 GCACTTGGGAGAGCTTTCAGTGG No data
1057747174_1057747176 -3 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747176 9:97761620-97761642 GGAGAGCTTTCAGTGGTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747174 Original CRISPR TCCCAAGTGCTTCACTGTCC TGG (reversed) Intergenic