ID: 1057747177

View in Genome Browser
Species Human (GRCh38)
Location 9:97761628-97761650
Sequence TTCAGTGGTGCTCGGACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747174_1057747177 5 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747177 9:97761628-97761650 TTCAGTGGTGCTCGGACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747177 Original CRISPR TTCAGTGGTGCTCGGACTTG AGG Intergenic