ID: 1057747179

View in Genome Browser
Species Human (GRCh38)
Location 9:97761637-97761659
Sequence GCTCGGACTTGAGGGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747174_1057747179 14 Left 1057747174 9:97761600-97761622 CCAGGACAGTGAAGCACTTGGGA No data
Right 1057747179 9:97761637-97761659 GCTCGGACTTGAGGGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747179 Original CRISPR GCTCGGACTTGAGGGCAGTC AGG Intergenic