ID: 1057747424

View in Genome Browser
Species Human (GRCh38)
Location 9:97763151-97763173
Sequence CAATATGCCTCAGGCTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747424_1057747434 9 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG No data
1057747424_1057747432 8 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747432 9:97763182-97763204 TCCTTAGAGGCAGAATGTGGAGG No data
1057747424_1057747435 20 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747435 9:97763194-97763216 GAATGTGGAGGGAGCTCCGACGG No data
1057747424_1057747437 27 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747437 9:97763201-97763223 GAGGGAGCTCCGACGGGTTATGG No data
1057747424_1057747431 5 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747431 9:97763179-97763201 TGATCCTTAGAGGCAGAATGTGG No data
1057747424_1057747436 21 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747436 9:97763195-97763217 AATGTGGAGGGAGCTCCGACGGG No data
1057747424_1057747428 -5 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747428 9:97763169-97763191 TATTGGCCCATGATCCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747424 Original CRISPR CAATATGCCTCAGGCTAGCT GGG (reversed) Intergenic
No off target data available for this crispr