ID: 1057747434

View in Genome Browser
Species Human (GRCh38)
Location 9:97763183-97763205
Sequence CCTTAGAGGCAGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747423_1057747434 10 Left 1057747423 9:97763150-97763172 CCCCAGCTAGCCTGAGGCATATT No data
Right 1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG No data
1057747427_1057747434 0 Left 1057747427 9:97763160-97763182 CCTGAGGCATATTGGCCCATGAT No data
Right 1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG No data
1057747424_1057747434 9 Left 1057747424 9:97763151-97763173 CCCAGCTAGCCTGAGGCATATTG No data
Right 1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG No data
1057747425_1057747434 8 Left 1057747425 9:97763152-97763174 CCAGCTAGCCTGAGGCATATTGG No data
Right 1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747434 Original CRISPR CCTTAGAGGCAGAATGTGGA GGG Intergenic
No off target data available for this crispr