ID: 1057747900

View in Genome Browser
Species Human (GRCh38)
Location 9:97766392-97766414
Sequence CCTTCTGTGCAGGAAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057747892_1057747900 4 Left 1057747892 9:97766365-97766387 CCAAAGGAGGATCTTGGGGCCCT No data
Right 1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057747900 Original CRISPR CCTTCTGTGCAGGAAAGGCA GGG Intergenic
No off target data available for this crispr