ID: 1057750264

View in Genome Browser
Species Human (GRCh38)
Location 9:97787301-97787323
Sequence GGTGGTCAGCTGATGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057750264_1057750272 12 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750272 9:97787336-97787358 CCCCCATTCAGAGGTGATGCTGG No data
1057750264_1057750276 14 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750276 9:97787338-97787360 CCCATTCAGAGGTGATGCTGGGG No data
1057750264_1057750274 13 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750274 9:97787337-97787359 CCCCATTCAGAGGTGATGCTGGG No data
1057750264_1057750270 3 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750270 9:97787327-97787349 TCATTTGCTCCCCCATTCAGAGG No data
1057750264_1057750278 17 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750278 9:97787341-97787363 ATTCAGAGGTGATGCTGGGGAGG No data
1057750264_1057750280 30 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750280 9:97787354-97787376 GCTGGGGAGGTGCTTCTTGCGGG No data
1057750264_1057750279 29 Left 1057750264 9:97787301-97787323 CCCTCTACCATCAGCTGACCACC No data
Right 1057750279 9:97787353-97787375 TGCTGGGGAGGTGCTTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057750264 Original CRISPR GGTGGTCAGCTGATGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr