ID: 1057753365

View in Genome Browser
Species Human (GRCh38)
Location 9:97810001-97810023
Sequence CTTGAAGTCCAACTCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057753365_1057753366 -1 Left 1057753365 9:97810001-97810023 CCAGGACAGAGTTGGACTTCAAG 0: 1
1: 0
2: 0
3: 19
4: 146
Right 1057753366 9:97810023-97810045 GTGCAGCTTTCCACCATCTATGG No data
1057753365_1057753369 19 Left 1057753365 9:97810001-97810023 CCAGGACAGAGTTGGACTTCAAG 0: 1
1: 0
2: 0
3: 19
4: 146
Right 1057753369 9:97810043-97810065 TGGAGAGAAAGACCATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057753365 Original CRISPR CTTGAAGTCCAACTCTGTCC TGG (reversed) Intergenic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
900940709 1:5796796-5796818 CTTGAAGACAGACTCTGTCGGGG - Intergenic
901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG + Exonic
901504450 1:9675717-9675739 CTGGAAGTCCAACTAAGTCCTGG - Intronic
902081647 1:13824987-13825009 CTTGAAGACCACCACTGACCAGG - Exonic
902810538 1:18885569-18885591 CTTCAGGTCCCACTCTTTCCGGG + Exonic
903430923 1:23299013-23299035 CTAGAAGTTCAAGACTGTCCTGG - Intergenic
905203874 1:36331777-36331799 CTAGAAGTTCAACTCTCTACCGG + Intergenic
906717630 1:47981955-47981977 CTTGAGGCCCAGCTCTGCCCTGG - Intronic
907353723 1:53854718-53854740 ATTGAAGTTCTACTCTGTGCTGG - Intronic
909415434 1:75401020-75401042 CTTCATTTCCTACTCTGTCCTGG + Intronic
909426866 1:75535637-75535659 CTAGAAGTCAAAATTTGTCCTGG - Intronic
913373137 1:118122824-118122846 CAAGAATCCCAACTCTGTCCTGG - Intronic
915896186 1:159813071-159813093 TTTGAAATCCAACTATGTGCTGG + Intronic
917036710 1:170755648-170755670 CTAGAAGTCCCATTCTCTCCTGG - Intergenic
918737365 1:188082376-188082398 CTTGAAGCAAAACTCTCTCCAGG - Intergenic
919726746 1:200889471-200889493 CTTGAACTCCAGCTCTTCCCTGG + Intergenic
923006214 1:230052153-230052175 CTTGGAGTGCATCTTTGTCCCGG - Intergenic
924909961 1:248499256-248499278 TTTGAAGCTCAACTCTGTCCAGG + Intergenic
924914143 1:248548799-248548821 TTTGAAGCTCAACTCTGTCCAGG - Intergenic
1065905749 10:30249582-30249604 CTTGAACTGCAACCCTTTCCTGG + Intergenic
1071000326 10:80824244-80824266 CATGAAGTTCAACTCTGTGGGGG - Intergenic
1071499960 10:86196245-86196267 CTAGAGCCCCAACTCTGTCCCGG - Intronic
1074188976 10:111119463-111119485 CTTGAACTACAACTCTTCCCTGG + Intergenic
1074316678 10:112367765-112367787 TTTGAAGACCACCTCTCTCCTGG + Intergenic
1077363369 11:2151094-2151116 CTTGAATCCAAACTCTGCCCTGG + Intronic
1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG + Intergenic
1078999907 11:16743008-16743030 CTTGAAGTTCAAACCTGTCTCGG + Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1084663077 11:70558415-70558437 CTTGAAGGCCAGCTCTGTGGCGG - Intronic
1089456383 11:118628199-118628221 CCTTAAGTCCATCTCTGTCCCGG + Exonic
1094350213 12:29515804-29515826 GTTGAAGGCCCACTATGTCCTGG - Intronic
1095719892 12:45388829-45388851 TTTGAGGTCCAACTCTGTTCAGG + Intronic
1097817578 12:64091460-64091482 CATTATGTCCAAGTCTGTCCTGG + Intronic
1098230485 12:68367951-68367973 CTTGTGGCCCATCTCTGTCCAGG - Intergenic
1099303169 12:80922813-80922835 CTTGCCTTCCATCTCTGTCCGGG + Intronic
1099655765 12:85488437-85488459 CTTGAAGTACAACTTACTCCAGG + Intergenic
1100308822 12:93376267-93376289 CTTGAAATTTAACTATGTCCAGG - Intergenic
1106759726 13:32857016-32857038 CCTGAGCTCCAACTCTGGCCGGG - Intergenic
1110132775 13:72027698-72027720 CATGAAGACTGACTCTGTCCTGG - Intergenic
1112189403 13:97161401-97161423 CTTGAAGTCCAACCCTGGCATGG - Intergenic
1113966739 13:114156795-114156817 CCTGAAGTCCATCTCTTTCGTGG + Intergenic
1114085982 14:19237208-19237230 CTTGATGTCCGCCTCAGTCCTGG - Intergenic
1118696240 14:68388396-68388418 CTAGAAGAACAACACTGTCCAGG - Intronic
1202897151 14_GL000194v1_random:16782-16804 CTTGATGACCAACTGGGTCCTGG - Intergenic
1202897524 14_GL000194v1_random:18832-18854 CTTGATGTCCACCTTAGTCCTGG - Intergenic
1124444768 15:29720937-29720959 CCTGGAGTCTAACTTTGTCCTGG - Intronic
1128243866 15:66119675-66119697 CTTTGAGTCCAACTCAGTCCCGG + Intronic
1128722923 15:69965427-69965449 CTCTAAGTGCAACTCTGTCCTGG - Intergenic
1133247822 16:4461089-4461111 TTTGAAGTTCACCTGTGTCCAGG + Intergenic
1134289809 16:12894942-12894964 CTTGCAGGCCAGCTGTGTCCAGG - Intergenic
1134771873 16:16816134-16816156 CCTGAATGCCAACACTGTCCTGG - Intergenic
1142178654 16:88656675-88656697 TGTGGAGTCCAGCTCTGTCCTGG - Intronic
1143566409 17:7723874-7723896 CTTAAAGCCCTCCTCTGTCCTGG - Intronic
1146559729 17:33857714-33857736 TTTGAATCCCAGCTCTGTCCTGG - Intronic
1146892634 17:36515867-36515889 CCTGAACTCCAACCCTGTCATGG - Exonic
1148757197 17:49979719-49979741 CTTGGAGTCCAGCTCTGCCACGG + Intergenic
1148776031 17:50096170-50096192 CTTGAAGATCAAATCTGTTCCGG + Intronic
1153663970 18:7351723-7351745 GTTAAAGTGCAACTCTGGCCGGG - Intergenic
1155603646 18:27577569-27577591 CTTGCATTACAACTCTTTCCTGG - Intergenic
1155856738 18:30844182-30844204 TGTGTAGTCCAACTCTTTCCAGG + Intergenic
1157672766 18:49544276-49544298 GTTGAAGTCTCACTCTGCCCAGG + Intergenic
1157829415 18:50843066-50843088 CTTGAACTGCAACTCTTCCCTGG - Intergenic
1159492796 18:69160250-69160272 CTTTAATTCCAAATCTGTTCAGG + Intergenic
1163084817 19:14971704-14971726 CTTGGAGGCCAACACTGGCCTGG + Intronic
1166278292 19:41771311-41771333 CTAGAAGTCCAACTCTGAAAAGG - Exonic
927717383 2:25361440-25361462 CTTGGCCTCCAACTCTGTGCTGG + Intergenic
928919761 2:36514330-36514352 CTTGAATTACAAATCTGTTCTGG - Intronic
929604082 2:43224156-43224178 CTTGGACTCGAACTCTGTGCCGG - Exonic
929917069 2:46144944-46144966 CTTGAAACCCATCTCAGTCCAGG - Intronic
932002912 2:67900835-67900857 CTTGAAATCCAACTGTCTGCAGG - Intergenic
932633365 2:73366342-73366364 CTTGAAGGCCCACTCTGAGCAGG - Intergenic
935110946 2:100093750-100093772 CTCCAAGTCAAACTCTGTCCTGG + Intronic
935284819 2:101555214-101555236 CTTGAAGTCTAACCCTCTCAGGG - Intergenic
936124030 2:109771412-109771434 CTCCAAGTCAAACTCTGTCCTGG - Intergenic
936220659 2:110600052-110600074 CTCCAAGTCAAACTCTGTCCTGG + Intergenic
936267419 2:111021204-111021226 CTTGTACTTCAACTCTGACCTGG + Intronic
938490771 2:131759881-131759903 CTTGATGTCCACCTTAGTCCTGG + Intronic
938491160 2:131762016-131762038 CTTGATGACCAACTGGGTCCTGG + Intronic
938496404 2:131800321-131800343 CTTGATGACCAACTGGGTCCTGG - Intronic
943483723 2:188454526-188454548 CTTCAAGTCAAAGGCTGTCCTGG - Intronic
943718460 2:191177932-191177954 CTTGAACTGCAACTCTTCCCTGG + Intergenic
943967806 2:194360400-194360422 CTTGAATTGAAACTCTGCCCTGG - Intergenic
1168919308 20:1517696-1517718 CTTTAAGTTCAACTCTGTCTTGG + Intergenic
1169141954 20:3231441-3231463 CTTGAATTCCTCCTCTGTGCGGG + Exonic
1171466163 20:25329282-25329304 ATTGAGGTCCAACTCTCTCATGG + Intronic
1171531626 20:25857088-25857110 CTTGACTTCCCAGTCTGTCCGGG - Intronic
1172838762 20:37889288-37889310 CTAGAAGTCCAGCACTGGCCAGG - Intergenic
1174057126 20:47805883-47805905 CCTGAAGTCCACCTCTGTTATGG - Intergenic
1176616836 21:9032771-9032793 CTTGATGACCAACTGGGTCCTGG - Intergenic
1176617210 21:9034821-9034843 CTTGATGTCCACCTTAGTCCTGG - Intergenic
1180291985 22:10855985-10856007 CTTGATGTCCGCCTCAGTCCTGG + Intergenic
1180494789 22:15885407-15885429 CTTGATGTCCGCCTCAGTCCTGG + Intergenic
1184199466 22:42956675-42956697 TTTCATGTCCACCTCTGTCCAGG - Intronic
953547755 3:43876196-43876218 CTTGAACTGCAACTCTTCCCTGG - Intergenic
955343764 3:58145826-58145848 CTTGACGTCCACCTCTCTACAGG - Intronic
955499807 3:59572614-59572636 CTTGAAGTCCACCCCCCTCCTGG + Intergenic
955909565 3:63846298-63846320 CCTGAAGTCCATTTTTGTCCAGG - Intronic
960467224 3:118011946-118011968 CTTGAATTCCAACTCTACTCAGG - Intergenic
962575133 3:136749450-136749472 CTTGAAAGACAACTCTGGCCGGG + Intronic
966202407 3:177370693-177370715 CTTCAATTCAAACTCTGTCAAGG + Intergenic
967686439 3:192421997-192422019 TTTGAAGTCCAACTATGACAGGG - Intronic
967759410 3:193206527-193206549 CTTGAACTGCAACTCTTCCCTGG + Intergenic
968649498 4:1754868-1754890 CTTGAACTCCAAATCTGCCCTGG + Intergenic
968708682 4:2096338-2096360 CTGGATGAACAACTCTGTCCTGG + Intronic
976962624 4:90997915-90997937 ATTGAAGTCCAGCTCTGTAAAGG + Intronic
984331112 4:178319816-178319838 CTTGCAGACCAGCTCTGTGCTGG - Intergenic
984358515 4:178696720-178696742 CATGTTGTCCAGCTCTGTCCTGG - Intergenic
984479849 4:180286163-180286185 CTTGAAGTCCTATTCTCTCAGGG + Intergenic
986571544 5:9170900-9170922 CTTCATGTCAAACTCTGTACAGG - Intronic
986763357 5:10900029-10900051 TTTGAAGGCCTACTCTGTGCCGG + Intergenic
992009177 5:72509878-72509900 CTGGAGCTCTAACTCTGTCCTGG + Intergenic
992051798 5:72947970-72947992 CTTGAATCCAACCTCTGTCCTGG + Intergenic
992907535 5:81361136-81361158 CTTAAAGTCCAAAACTGCCCTGG + Intronic
993160098 5:84279193-84279215 CATTAAGTCCAACTCCCTCCAGG + Intronic
995344198 5:111092661-111092683 CTTGGCCTCTAACTCTGTCCTGG + Intronic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
998391857 5:141792334-141792356 TTTAAAATCCAACTCTGGCCGGG + Intergenic
999312513 5:150560689-150560711 CTTGAACTCCAACAATGTCAAGG + Intergenic
1004186180 6:13423174-13423196 CTTGAAATCTAACACTGTCTGGG - Intronic
1004229486 6:13818199-13818221 CATAAAGTCCAACTTTGTCATGG - Intergenic
1004900090 6:20185526-20185548 CTTGAACTTCAAATCTTTCCTGG + Intronic
1006695738 6:35929128-35929150 CATGCTTTCCAACTCTGTCCAGG - Intergenic
1008901007 6:56616007-56616029 CTTGAAGCCCAAGTCAGTACAGG - Intronic
1012828783 6:104180599-104180621 CTTCAAGTCCACCTTTGGCCAGG + Intergenic
1014382799 6:120764611-120764633 ATTGAATTCCACCTCTATCCTGG + Intergenic
1017008137 6:150043050-150043072 CTTGAAGGCCAGATGTGTCCAGG - Intergenic
1018865812 6:167746286-167746308 CGTGAAGCCCAGCTCTGGCCGGG - Intergenic
1019180982 6:170187194-170187216 CTTGAAGCCCAACATTGTCCAGG + Intergenic
1019596535 7:1860993-1861015 GATGGAGTCCACCTCTGTCCTGG + Intronic
1020100767 7:5393270-5393292 CTAGAAGGCCCACTCTGTGCAGG + Intronic
1021038651 7:15833197-15833219 TTTGAAGCCCAGCTCTGGCCTGG - Intergenic
1021814693 7:24435765-24435787 CTTGAACTGCAACTCTTCCCTGG + Intergenic
1027171213 7:75874072-75874094 CCTGAAGGCCTACTCTGTGCAGG + Intronic
1035101259 7:156398821-156398843 CTTTAAGACAAACTCTGCCCAGG + Intergenic
1038160214 8:25030213-25030235 TTTGAAGTTCAAATCTGGCCAGG - Intergenic
1040317976 8:46275009-46275031 CTTAAAGTCCACCTGAGTCCCGG - Intergenic
1041878286 8:62715746-62715768 CTTGAAATCCAACTCCCACCAGG - Intronic
1042530711 8:69811884-69811906 TTTGAATTCCCACTTTGTCCTGG - Intronic
1043474111 8:80589820-80589842 CTAGAAGACCAAGTGTGTCCAGG + Intergenic
1048434197 8:134400549-134400571 CCTGAAGAACAACTCAGTCCTGG - Intergenic
1049992026 9:999582-999604 CTTGAAGTCCACTCCTGTCCAGG + Intergenic
1050707603 9:8420946-8420968 CTTGATGTCCTGCACTGTCCTGG + Intronic
1052679684 9:31673399-31673421 CTACATGTCCAACTCTGGCCAGG + Intergenic
1055055824 9:72023030-72023052 CTAGAAGTCCAAGCCTCTCCAGG + Intergenic
1057640603 9:96817026-96817048 CAAGAAGTCCAACTGTGTACAGG + Exonic
1057753365 9:97810001-97810023 CTTGAAGTCCAACTCTGTCCTGG - Intergenic
1057973427 9:99579081-99579103 CTTGGGGTCAAACTCTGTGCTGG + Intergenic
1058109870 9:101020582-101020604 GTTGAATTCCAGCTCTGTCAGGG - Intergenic
1059141590 9:111858038-111858060 ATACAAGTCCAAATCTGTCCTGG + Intergenic
1062640619 9:137516183-137516205 CTTGAAGGCAAACTCCATCCAGG + Intronic
1185752289 X:2622416-2622438 TTGGAATTCCAACTCTGTCCAGG + Intergenic
1185938063 X:4281583-4281605 CTTGCAGAGCAATTCTGTCCAGG + Intergenic
1186079001 X:5910268-5910290 CTTTATGTCCAAATCTGTACTGG + Intronic
1186188568 X:7045470-7045492 CTTGCAGTCTAACTCTTTCCAGG + Intergenic
1188527850 X:31105606-31105628 CTTGAACTGCAACTCTTCCCTGG + Intronic
1189409779 X:40759989-40760011 CTCTAAGTCCAACTCTGCCAAGG - Intergenic
1190511316 X:51176621-51176643 CTTGAAGTTCAGTTCTGTGCAGG + Intergenic
1191859006 X:65650592-65650614 ATTGAGGTCCTACTCTGTGCTGG + Intronic
1194742309 X:97588501-97588523 ATTGAAGTAAAACTCTCTCCAGG + Intronic
1199220785 X:145313857-145313879 CTGGAACTCCAATTCTCTCCTGG - Intergenic
1199948913 X:152689897-152689919 CTTGAGAGCCAACTCTGTCCAGG + Intergenic
1199960763 X:152778552-152778574 CTTGAGAGCCAACTCTGTCCAGG - Intergenic
1201150237 Y:11091622-11091644 CTTGATGACCAACTAGGTCCTGG - Intergenic
1201150601 Y:11093654-11093676 CTTGATGTCCACCTTAGTCCTGG - Intergenic
1201721559 Y:17103981-17104003 CTTGCAGAGCAATTCTGTCCAGG + Intergenic