ID: 1057756505

View in Genome Browser
Species Human (GRCh38)
Location 9:97842398-97842420
Sequence CAGTGCCAAGGTAATTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057756502_1057756505 28 Left 1057756502 9:97842347-97842369 CCAGTATAAGTAGAGAGAAAAAT No data
Right 1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057756505 Original CRISPR CAGTGCCAAGGTAATTCAAT GGG Intergenic
No off target data available for this crispr