ID: 1057757927

View in Genome Browser
Species Human (GRCh38)
Location 9:97852450-97852472
Sequence CAGGATCTGTCTCTATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057757927_1057757936 4 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757936 9:97852477-97852499 TCTCAAAGACGGATGATTGGGGG No data
1057757927_1057757932 1 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757932 9:97852474-97852496 GCCTCTCAAAGACGGATGATTGG No data
1057757927_1057757934 2 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757934 9:97852475-97852497 CCTCTCAAAGACGGATGATTGGG No data
1057757927_1057757938 14 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757938 9:97852487-97852509 GGATGATTGGGGGTGGTGATTGG No data
1057757927_1057757930 -7 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757930 9:97852466-97852488 GATCCTGGGCCTCTCAAAGACGG No data
1057757927_1057757937 7 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757937 9:97852480-97852502 CAAAGACGGATGATTGGGGGTGG No data
1057757927_1057757935 3 Left 1057757927 9:97852450-97852472 CCATCAAATAGAGACAGATCCTG No data
Right 1057757935 9:97852476-97852498 CTCTCAAAGACGGATGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057757927 Original CRISPR CAGGATCTGTCTCTATTTGA TGG (reversed) Intergenic
No off target data available for this crispr