ID: 1057761410

View in Genome Browser
Species Human (GRCh38)
Location 9:97877642-97877664
Sequence TCTTCTCCAGAGACCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057761410_1057761414 19 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761414 9:97877684-97877706 GAAATGGTTCTCACCCAGCTGGG No data
1057761410_1057761412 3 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761412 9:97877668-97877690 AAGAAGATGGATCTAAGAAATGG No data
1057761410_1057761413 18 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761413 9:97877683-97877705 AGAAATGGTTCTCACCCAGCTGG No data
1057761410_1057761415 27 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761415 9:97877692-97877714 TCTCACCCAGCTGGGCACAGTGG No data
1057761410_1057761411 -10 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057761410 Original CRISPR TCTTCTCCAGAGACCCACAC AGG (reversed) Intergenic
No off target data available for this crispr