ID: 1057761411

View in Genome Browser
Species Human (GRCh38)
Location 9:97877655-97877677
Sequence CTGGAGAAGAAGAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057761410_1057761411 -10 Left 1057761410 9:97877642-97877664 CCTGTGTGGGTCTCTGGAGAAGA No data
Right 1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057761411 Original CRISPR CTGGAGAAGAAGAAAGAAGA TGG Intergenic
No off target data available for this crispr