ID: 1057763109

View in Genome Browser
Species Human (GRCh38)
Location 9:97892105-97892127
Sequence CCCCAGATCCTGCTGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057763109_1057763119 30 Left 1057763109 9:97892105-97892127 CCCGTCAGCAGCAGGATCTGGGG No data
Right 1057763119 9:97892158-97892180 CATCCAACACCAGCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057763109 Original CRISPR CCCCAGATCCTGCTGCTGAC GGG (reversed) Intergenic
No off target data available for this crispr