ID: 1057763119

View in Genome Browser
Species Human (GRCh38)
Location 9:97892158-97892180
Sequence CATCCAACACCAGCCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057763109_1057763119 30 Left 1057763109 9:97892105-97892127 CCCGTCAGCAGCAGGATCTGGGG No data
Right 1057763119 9:97892158-97892180 CATCCAACACCAGCCCCACCTGG No data
1057763116_1057763119 -5 Left 1057763116 9:97892140-97892162 CCACCATTGAAAGAGCCTCATCC No data
Right 1057763119 9:97892158-97892180 CATCCAACACCAGCCCCACCTGG No data
1057763117_1057763119 -8 Left 1057763117 9:97892143-97892165 CCATTGAAAGAGCCTCATCCAAC No data
Right 1057763119 9:97892158-97892180 CATCCAACACCAGCCCCACCTGG No data
1057763111_1057763119 29 Left 1057763111 9:97892106-97892128 CCGTCAGCAGCAGGATCTGGGGG No data
Right 1057763119 9:97892158-97892180 CATCCAACACCAGCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057763119 Original CRISPR CATCCAACACCAGCCCCACC TGG Intergenic
No off target data available for this crispr