ID: 1057766118

View in Genome Browser
Species Human (GRCh38)
Location 9:97920940-97920962
Sequence AACAGGGAGGTGGGAACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057766118 Original CRISPR AACAGGGAGGTGGGAACCTT TGG (reversed) Intronic
901223327 1:7596467-7596489 GACAGGGAAGTGGGCACCTGCGG - Intronic
902400220 1:16153343-16153365 AGCAGGGAGGTGGGGACTCTGGG + Intronic
902540281 1:17149509-17149531 AAGAGGGAGGTGGGGCCTTTGGG - Intergenic
902793267 1:18783633-18783655 GAGAGGGAGGAGGGAATCTTGGG + Intergenic
903339855 1:22647164-22647186 GACAGGGAGGAGGGACCCTGAGG - Intronic
904856736 1:33503503-33503525 TGCAGGGAGGTGGGATCCTCTGG - Intergenic
905233631 1:36530562-36530584 AACAGGGATGGGGAAGCCTTGGG - Intergenic
906495832 1:46303183-46303205 AACAGGGCGGGGGGAGCGTTGGG + Exonic
906680562 1:47723188-47723210 ATCAGGCAGGTGAGGACCTTGGG - Intergenic
907251576 1:53143077-53143099 AAAATGAAGGTGGGAACCCTGGG - Intergenic
916423418 1:164658309-164658331 AACAGGCTGATGAGAACCTTTGG - Intronic
916515447 1:165512499-165512521 AACAGGGTGTTGGGCACCTATGG - Intergenic
917034559 1:170733314-170733336 AAAAGGGAGATTAGAACCTTGGG - Intronic
920616931 1:207502801-207502823 AACAGGGAAAAGGCAACCTTAGG + Intronic
921305735 1:213794766-213794788 AACATGGATGTGGGCACTTTGGG - Intergenic
923124514 1:231023329-231023351 CACAGGTAGGTGGGAGCCTCAGG + Intronic
923321845 1:232842110-232842132 GACAGGGAGGCTGGAACCTATGG - Intergenic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1068858342 10:61820735-61820757 AAAAGGGAGGAGGGAAAGTTTGG - Intergenic
1069753402 10:70759335-70759357 AAGAGGGAGGTGGGAAGAGTGGG - Intronic
1070464299 10:76704030-76704052 AACCTGGATTTGGGAACCTTAGG - Intergenic
1070653478 10:78254651-78254673 AAGAGGGAGGTGGGTTCCTAGGG + Intergenic
1070825619 10:79388779-79388801 CACAGGGAGGTGGTGACATTAGG - Intronic
1071506590 10:86235514-86235536 AACAGGCATGAGGGGACCTTTGG - Intronic
1072800876 10:98391579-98391601 AACAGGGAGGGGTGAGCTTTGGG - Intronic
1074628487 10:115221248-115221270 AACAGGGTGTTGAGAACCCTGGG + Intronic
1074926645 10:118079680-118079702 ATCAGGGAGCTGGGATCTTTTGG + Intergenic
1075441927 10:122486615-122486637 AGCAGGGATGTGGGAACCAGTGG + Intronic
1076382412 10:130033948-130033970 AACAGAGCCGTGGGAACCTAGGG - Intergenic
1078026504 11:7700672-7700694 AAAAGGGAGGTGGGATTGTTGGG - Intronic
1079116178 11:17641925-17641947 AACAGGGAGGTGGTGCCATTGGG - Exonic
1079570884 11:21942204-21942226 AACAGGGTGGTGAGATCCCTGGG - Intergenic
1081532194 11:43969703-43969725 ACCAGGGAAGTGGGAAGCTGGGG - Intergenic
1081821848 11:46005508-46005530 AACAGGAAGGTCTGAACATTTGG - Intronic
1086960686 11:92977637-92977659 AACAAGGTGGTGGGAACAGTGGG - Intronic
1087629048 11:100628810-100628832 AACAAAAAGGTGGGAACCCTGGG + Intergenic
1090232879 11:125121553-125121575 AACAGTGAAGTGGGCAGCTTTGG - Intergenic
1090296595 11:125593257-125593279 AAGAGGGAGGTGGGACCCGCTGG + Intronic
1090873246 11:130766545-130766567 AACAAGAAGGTGTGAACCTCAGG - Intergenic
1092007451 12:5081264-5081286 AGCAGGGCGGAGGGAAGCTTTGG + Intergenic
1093389546 12:18602116-18602138 AGCTGGGAGGTGGAAAGCTTTGG + Intronic
1099577292 12:84396804-84396826 AAAAGAGAGGAGAGAACCTTTGG - Intergenic
1100274479 12:93059205-93059227 AAAAGGGAAGCAGGAACCTTAGG + Intergenic
1100742934 12:97615203-97615225 AACAGAGAAATGGGGACCTTGGG - Intergenic
1102432812 12:112896939-112896961 ATCAGGGAGGAGGGAGTCTTTGG - Exonic
1103734071 12:123047761-123047783 AAAAGGGTGGGGGGAACCTGAGG + Intronic
1104472861 12:129044621-129044643 AACAGGCAGGTGGGAAGGTGTGG + Intergenic
1105369750 13:19792159-19792181 AATAGGGAGCGGGGTACCTTAGG + Intergenic
1106577355 13:30987880-30987902 AAAAGGGAGTGGTGAACCTTGGG - Intergenic
1110416099 13:75254588-75254610 ACTAGGGAGGAGGGAAACTTAGG - Intergenic
1110759745 13:79218521-79218543 AAGAGTGAGTTGGAAACCTTGGG - Intergenic
1111963803 13:94840198-94840220 AAGAGGGAAGTGGTTACCTTTGG + Intergenic
1113181446 13:107632459-107632481 ATTAGGGAGGTGGGTTCCTTAGG - Intronic
1118766738 14:68915159-68915181 CTCAGGGAGGTGGGAAGCTGTGG - Intronic
1118807745 14:69252492-69252514 AACTGGGAGATGGGAAACCTGGG - Intergenic
1119391337 14:74293118-74293140 CCCAGGGAAGTGGGAACCATGGG - Intronic
1120167155 14:81213306-81213328 AAAATGGAGGTGGAAACATTTGG + Intronic
1120950393 14:90035751-90035773 AACAGGGAGGAGGAGAACTTGGG - Intronic
1120970805 14:90205367-90205389 AGCAGGGAGGTGGGAATCCCAGG + Intergenic
1121016593 14:90552830-90552852 AGCAGGGAGGTGGCAGCCATGGG - Intronic
1121448581 14:93993792-93993814 TACAGGCAGCTGGGAATCTTGGG - Intergenic
1121684154 14:95819837-95819859 AACATGGTGGTGGGTTCCTTGGG + Intergenic
1123942904 15:25225178-25225200 TGCAGGGAGGTGGGTGCCTTGGG + Intergenic
1124041718 15:26111502-26111524 CACAGGGATGTGGAAACGTTCGG + Intergenic
1126156411 15:45569535-45569557 ACCAGGAAGGTGAGAATCTTGGG - Intergenic
1126475698 15:49063252-49063274 AAAAATGAGGTGGGAAGCTTAGG - Intergenic
1126966959 15:54065197-54065219 AACAGAGAGGTGGGCCCCTGAGG - Intronic
1127827772 15:62719883-62719905 AACAGGGCTGTGGTCACCTTGGG + Intronic
1128145754 15:65331679-65331701 TCCAGGGAGGAGGGAACCTGAGG - Intronic
1129297250 15:74606389-74606411 TACAGGCAGGTGGGGACCCTGGG - Intronic
1129688773 15:77701419-77701441 GCCAGGGAGGTGGGATGCTTTGG - Intronic
1130203809 15:81857152-81857174 AACAAGGATGTGGAAACATTGGG + Intergenic
1130585289 15:85175878-85175900 TACAGGGAGGTAGGAATGTTGGG + Intergenic
1132478233 16:153147-153169 GACAGTGAGGAGGGGACCTTGGG + Intronic
1132480270 16:163611-163633 GACAGTGAGGAGGGGACCTTGGG + Intronic
1138997510 16:62473179-62473201 GACAGAAAGGTGGGAAACTTTGG + Intergenic
1139247854 16:65463784-65463806 AACAAAGAGGTGGGACCTTTTGG - Intergenic
1139847177 16:69929365-69929387 ACCCAGGAGGTGGGAACCTCAGG + Intronic
1142170285 16:88618394-88618416 AAAAGGGAGATGGGAGCCTATGG - Intronic
1142748131 17:1970757-1970779 AACAGGGTGGTAGGAGCCTGGGG - Intronic
1142804363 17:2363718-2363740 AACAGGGAGTTGGGAGGCTGGGG - Intronic
1142923967 17:3216336-3216358 AACCGTGAGGTGGGAACCACAGG - Exonic
1143267752 17:5653168-5653190 AAAAGGGCAGTGGTAACCTTTGG - Intergenic
1146846079 17:36182968-36182990 ACCAGAGAGGTGGGAAGTTTGGG + Intronic
1147305533 17:39561658-39561680 AGGTGGGAGGTGGGAGCCTTTGG - Intronic
1147318683 17:39633184-39633206 CAGAGGGAGCTGGGAACCTGGGG + Intronic
1148467963 17:47876139-47876161 AACAGGGACTTGGGATCCTCTGG + Intergenic
1150216945 17:63476522-63476544 AGGAGGGAGGCGGGGACCTTAGG - Intergenic
1150217428 17:63478174-63478196 ATCAGGGAGGGAGGAACCCTGGG + Intergenic
1153400435 18:4678835-4678857 AGCTGGGAGGTGGGTACCCTGGG + Intergenic
1155079783 18:22397501-22397523 CACTGGGAGGTGGGACTCTTGGG - Intergenic
1156045387 18:32871793-32871815 AGCAGGGAGGTGGGACCGCTTGG - Intergenic
1156482392 18:37444506-37444528 AGCAGGGCAGTGGGAATCTTTGG - Intronic
1157043896 18:44072667-44072689 ACCAGGGAGGTGAGAGACTTTGG - Intergenic
1157044140 18:44077130-44077152 AACAGCGATGGGGGAATCTTAGG + Intergenic
1158419296 18:57278711-57278733 AAGAAGGAGGTGGAAACTTTAGG - Intergenic
1158939149 18:62390984-62391006 AAAAGGGAAATGGGAACTTTGGG - Exonic
1159049856 18:63410167-63410189 AACAGGCAGCTGGGCAGCTTTGG + Intronic
1160706376 19:532049-532071 AACTGGGAGGTGGCCATCTTCGG + Exonic
1163611881 19:18305934-18305956 AACAGGCAGGTGGGTGCCGTGGG + Intergenic
1166646522 19:44535889-44535911 AACTAGGATGTGGGCACCTTTGG + Intergenic
1166966470 19:46532105-46532127 TGGAGGGAGGTGGGAATCTTTGG - Intronic
1167292991 19:48634874-48634896 AGCAGGGGGTTGGGAATCTTTGG - Intronic
925321068 2:2969005-2969027 AGCAGGGAGGTGGGAAGATATGG + Intergenic
925417024 2:3677587-3677609 CACAGGAAGGTGGGTACCGTTGG + Intronic
925600002 2:5598564-5598586 GAGAGAGAGGTGGGAAACTTGGG + Intergenic
927347187 2:22058577-22058599 GACAGGGAAGTGGGAAGTTTTGG - Intergenic
928394180 2:30931468-30931490 AACAGGCAAGTGGGCACCCTTGG + Intronic
929097944 2:38281693-38281715 AACAGGCAGGTAGGAATGTTTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932787537 2:74620523-74620545 AACTGGGAGTTGGGAAATTTGGG + Intronic
934651517 2:96093790-96093812 CACAGGGAGGAGGGGGCCTTTGG + Intergenic
935402556 2:102675351-102675373 TATAGGCAGGTGGGAGCCTTTGG + Intronic
936883583 2:117282669-117282691 AACAGGAAGGAAGGAACTTTGGG - Intergenic
938038127 2:128053436-128053458 AACTGGGAGGTGGGAAGCCATGG - Intergenic
942620415 2:177839068-177839090 TACAGGGAGGTGGTAAGTTTGGG + Intronic
943890675 2:193282311-193282333 AACAGGGAGGTGTAAAACATAGG - Intergenic
944210434 2:197201445-197201467 ATCAGGGAGATAGGATCCTTTGG + Intronic
946177724 2:217931659-217931681 AACAGGGAGGTGAACACCTGTGG - Intronic
946336922 2:219043817-219043839 AAAAGGCAGGTGGGAAAATTGGG + Intergenic
946787551 2:223263541-223263563 GAAAGGGAGATGGGGACCTTTGG - Intergenic
1169719384 20:8657118-8657140 AACAGGGAGGGAGGAAGCTGGGG + Intronic
1172631925 20:36384332-36384354 AACTGGGAGGTCAGAAGCTTTGG + Intronic
1172950030 20:38717279-38717301 GACAGGGAGGTGGGAGGCATAGG - Intergenic
1174882423 20:54294816-54294838 AAGAGGGAAGTGGGAAAGTTGGG - Intergenic
1175334401 20:58185662-58185684 ACAAGGGAGGTGGTCACCTTTGG - Intergenic
1175862635 20:62158298-62158320 CACAGGGAGGTGTGAATGTTCGG + Intronic
1175979142 20:62728239-62728261 AGGAGGGAGATGGGTACCTTGGG + Intronic
1182310606 22:29402899-29402921 AGCAGGGAGGTGTGAGCCATTGG + Intronic
1182690444 22:32157847-32157869 AGCAGGGAGGTGTGAGCCATTGG - Intronic
1183016993 22:34996883-34996905 AAGGGGAAGGTGGGAACCTGTGG + Intergenic
1183199554 22:36376436-36376458 AACAGGGAGTTGGGATACTGAGG - Intronic
1184111658 22:42399075-42399097 AAGAGGGAGGAGGGAGCCTCAGG + Intronic
949518408 3:4827726-4827748 AACAGGAAGGTGTGATCCTTAGG + Intronic
950678335 3:14568138-14568160 CAGAGGGAGGTGGGAGCCATGGG + Intergenic
951035243 3:17925555-17925577 AACAGGGAGGAGGCAAAATTTGG + Intronic
951066750 3:18275953-18275975 AATTAGGAGGTGGGGACCTTTGG + Intronic
954578701 3:51691356-51691378 CACAGGGAGGAGGGCACTTTTGG + Intronic
956017615 3:64900367-64900389 AAAAGGGAGATGTGAAACTTTGG + Intergenic
957121831 3:76103632-76103654 TACTGGGAGCTGGGAAGCTTAGG + Intronic
958138679 3:89531957-89531979 AACAGGGAGGTGGGAAATCAAGG - Intergenic
959351532 3:105271066-105271088 AACAAGGAAATGGGAACTTTAGG + Intergenic
959997224 3:112693206-112693228 AGCTGGGAGGTGGGTACCCTGGG + Intergenic
960629652 3:119717077-119717099 AAGAAGTAGCTGGGAACCTTTGG + Intronic
961109412 3:124271250-124271272 GAAAGGGAGGTGGGAGACTTAGG + Intronic
968231406 3:197006829-197006851 CACAGGGAGGTGGCAACATCTGG + Intronic
969238589 4:5885343-5885365 AACAAGCAGGTGGGGACCTGGGG + Intronic
969553810 4:7892474-7892496 AACGGGGAGGTGGGAATCATTGG + Intronic
970235336 4:13952914-13952936 ATCAGGGATGTGGGAACCCTGGG + Intergenic
972089395 4:35261029-35261051 CACCAGGAGGTGGAAACCTTGGG + Intergenic
973168511 4:47109278-47109300 AACATAGAGGTGGGTAACTTAGG + Intronic
973784398 4:54321491-54321513 AACAAAGAGGTGGGAATCTGAGG - Intergenic
974279871 4:59779270-59779292 AAGACAGAGGTGGGAACCTCAGG + Intergenic
975478003 4:74844798-74844820 AAAAGGGAGGGGGGAAACTTTGG - Intergenic
981589601 4:146345160-146345182 AACAGTGACGTGGGAACCACAGG + Intronic
982361111 4:154520033-154520055 ACCAGGGAGGTGGAAACTGTTGG - Intergenic
983562410 4:169114332-169114354 AAAAGGGAGGCAGGAAGCTTAGG - Intronic
984561528 4:181276450-181276472 TACTGGGAAGTGGGAACTTTGGG - Intergenic
984930553 4:184843601-184843623 AATAGTGAGGTGTAAACCTTGGG + Intergenic
987672500 5:21029810-21029832 AGCATGGGGGTGGGATCCTTGGG + Intergenic
988469598 5:31526389-31526411 AACTGGGAGGTGGGAAGTTGTGG + Exonic
988581763 5:32474614-32474636 AGCAGGGAGGGTGGAAACTTGGG + Intergenic
990954497 5:61329915-61329937 AACAGGGAAGTAGGTACCTTTGG - Intergenic
992342865 5:75844153-75844175 AACAGTCACGTTGGAACCTTGGG + Intergenic
996504834 5:124257427-124257449 AACTGGGAGGTGGGTAGCCTGGG - Intergenic
997430414 5:133835193-133835215 AAGAGGCAGGCGGGAACATTGGG + Intergenic
998886731 5:146702153-146702175 AACAGTGAGGTGGAAAACTAAGG + Intronic
999257172 5:150216180-150216202 GACAGGGAAGTGGGAAGCCTGGG + Intronic
1000046397 5:157525339-157525361 CTCAGGGAGGTGGGAGCCTGGGG - Intronic
1000614609 5:163413342-163413364 AGCAGGCACGTGGGCACCTTTGG - Intergenic
1001207237 5:169775709-169775731 AACAGGGCTGTTGGAACATTGGG + Intronic
1002294475 5:178222675-178222697 AGCAGTAAGGTGGGGACCTTGGG + Intronic
1002301056 5:178257458-178257480 ACCAGGTAGATGGGAACCATGGG + Intronic
1007380459 6:41487239-41487261 ACCAATGAGGTGGGGACCTTTGG + Intergenic
1009028607 6:58029966-58029988 CCCAGGGATGTGGGAATCTTTGG - Intergenic
1009204138 6:60781353-60781375 CCCAGGGATGTGGGAATCTTTGG - Intergenic
1011729083 6:90241998-90242020 AACGGGGAAGAGGGAACTTTTGG - Intronic
1012445902 6:99306943-99306965 AAGAGGGAGCTGGGAATCTCTGG + Intronic
1013554318 6:111240865-111240887 AAAAAGGAGGTGGGACCTTTAGG - Intergenic
1014294863 6:119605786-119605808 ATCAGGAAGGTGGGGACTTTGGG - Intergenic
1014850563 6:126335335-126335357 AAGAGGGAGGAAGGAACCATGGG + Intergenic
1015883154 6:137890430-137890452 AACAAGGAGTTGTGATCCTTTGG + Intergenic
1017080545 6:150664403-150664425 AACAAGGAAGTGGTTACCTTGGG + Intronic
1017430900 6:154369807-154369829 AAGAGGGAGGTGGGAACATCAGG - Intronic
1019071780 6:169352911-169352933 GACAAGGAGGTGTGATCCTTTGG + Intergenic
1019170785 6:170132194-170132216 AAAAGGGAGGAGGGAACCCACGG + Intergenic
1020373655 7:7461466-7461488 AGCTGGGAGGTGGGAAGCCTGGG + Intronic
1020623673 7:10550627-10550649 AAAAGGGAGGTAAGAACCTACGG - Intergenic
1021926512 7:25539500-25539522 GCCAGGGATGTGGTAACCTTTGG - Intergenic
1023861703 7:44220770-44220792 GACAAGGATGTGGGACCCTTGGG - Intronic
1025718264 7:63983759-63983781 AACATGGAGTCAGGAACCTTAGG - Intergenic
1026733237 7:72929621-72929643 TACAGGCATGTGGGAACTTTTGG - Intronic
1027110796 7:75437977-75437999 TACAGGCATGTGGGAACTTTTGG + Intronic
1028103547 7:86850439-86850461 AACAGGATGATGTGAACCTTGGG - Exonic
1029942826 7:104497992-104498014 TTTAGGGAGGTGGGAACCCTAGG + Intronic
1033511657 7:142065504-142065526 GGCAGGGAGTTGGGATCCTTAGG + Intronic
1033514729 7:142094532-142094554 GGCAGGGAGTTGGGATCCTTGGG + Intronic
1034379284 7:150675968-150675990 AACTGGGAGGGGGGAAGATTGGG + Intergenic
1034479325 7:151307675-151307697 AACAGGGAGATGTGAACATTTGG - Intergenic
1034480899 7:151319924-151319946 AACAGGGAGGTGGGCCACCTGGG + Intergenic
1034787979 7:153942707-153942729 CACAGGAAGGTGGGATCCCTGGG + Intronic
1035413519 7:158665638-158665660 AACCAGGAGATGGGAACCTCAGG - Intronic
1037816680 8:22116241-22116263 CACAGGGAGGTGGGAGGCTTGGG + Intronic
1038528922 8:28300994-28301016 AATAGGGAATTGGGAACCATGGG - Intergenic
1038808168 8:30813088-30813110 GACAGGGAGTTGGAAAACTTGGG + Intronic
1041329088 8:56704236-56704258 TACTGGGAGGTGGGACCTTTAGG - Intergenic
1042236114 8:66614177-66614199 ACCAGGGAGGGGGGAACCACCGG + Intronic
1044834372 8:96281462-96281484 TCCAGGGAGGTGGGAACCACTGG - Intronic
1045260408 8:100568336-100568358 AACAAGTAGGTGCCAACCTTTGG - Intergenic
1045493320 8:102687041-102687063 AACTGGAAGGTGGATACCTTTGG - Intergenic
1046364396 8:113207216-113207238 AACATGGTGGTGGCTACCTTGGG + Intronic
1048211552 8:132458218-132458240 TGCTGGGAGGTAGGAACCTTAGG - Intronic
1048379187 8:133849303-133849325 CACAGGAGGGTAGGAACCTTGGG + Intergenic
1048491301 8:134896280-134896302 AAGAGGAATGTGGGAGCCTTTGG - Intergenic
1048941360 8:139403370-139403392 AGCAGGGGAGTGGGAACCCTTGG - Intergenic
1049541564 8:143211390-143211412 GACAGGGAGGTGGGACGCTGGGG + Intergenic
1051030241 9:12665864-12665886 AACAGACATGTGGGAACCTTTGG + Intergenic
1051619989 9:19040809-19040831 AACAGGGAGAAGGGAACTTTTGG + Intronic
1052647321 9:31253735-31253757 TATAAGGAGGTGGGAACCTTTGG + Intergenic
1052904022 9:33817875-33817897 AACTGGGAGGTGGCCATCTTCGG + Exonic
1055856179 9:80691364-80691386 AACAGGGCAGTGGGGATCTTGGG - Intergenic
1056282674 9:85057173-85057195 CACAGGGAGGTGGGCAGCATGGG + Intergenic
1057046780 9:91892280-91892302 CACCGGCAGGTGGGAAACTTGGG + Intronic
1057149939 9:92787561-92787583 AACAGGGAGTTGGGAGCCTGGGG - Intergenic
1057766118 9:97920940-97920962 AACAGGGAGGTGGGAACCTTTGG - Intronic
1058958177 9:109968573-109968595 CAAAGGGAGGTGGGAAACCTGGG + Intronic
1059107603 9:111525074-111525096 AACAGGCAGGTGGGAGCCTATGG + Intergenic
1059421377 9:114194562-114194584 GGCAGGGAGGTGGGAACATCTGG + Intronic
1060961536 9:127684079-127684101 TATCGGGAGGTGGGAACCTGGGG + Intronic
1060970258 9:127733771-127733793 AACAGGGAAGTGGGAGGCTTGGG - Intronic
1061257170 9:129459821-129459843 ATCAGGGAGGTGGGAAGGCTGGG + Intergenic
1061483050 9:130906583-130906605 GTCAGGGAGGTGGGGACCCTGGG - Intronic
1062308231 9:135921562-135921584 CCCACGGAGGTGGGAACCTGGGG - Intergenic
1062327051 9:136017487-136017509 AACAGGGAAGTGGGAGCCCCAGG - Intronic
1187567937 X:20470953-20470975 AACAAGAAGGTGGGAAGCTGAGG - Intergenic
1188908163 X:35812991-35813013 GAGAGGGAGGTGGGAAAATTAGG + Intergenic
1190735260 X:53251464-53251486 ATCAGGGAGGAGGTAACGTTTGG - Intronic
1194139984 X:90197056-90197078 AACAAGGAGCTGTGATCCTTTGG - Intergenic
1197476349 X:126929853-126929875 AACTGGGAGGTGGGTAGCCTGGG - Intergenic
1197855560 X:130910498-130910520 ACCAGGGAGCTGGTAACCCTGGG + Intergenic
1199527904 X:148812601-148812623 ATCAGGGAGGTGGGAAAGTTGGG - Intronic
1199676034 X:150190056-150190078 GACAGGGAAGTGGCACCCTTGGG + Intergenic
1200308569 X:155053996-155054018 AGAGGGGAGGTGGGAAGCTTTGG + Intronic
1200485730 Y:3766025-3766047 AACAAGGAGCTGTGATCCTTTGG - Intergenic
1202584803 Y:26410404-26410426 ACCTGGGATGTGGAAACCTTGGG + Intergenic