ID: 1057766135

View in Genome Browser
Species Human (GRCh38)
Location 9:97921046-97921068
Sequence CAAAATATGAGACCTGTAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057766132_1057766135 3 Left 1057766132 9:97921020-97921042 CCTGGCTTCTGCGTTTTCCTTCC 0: 1
1: 1
2: 4
3: 53
4: 474
Right 1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG No data
1057766129_1057766135 27 Left 1057766129 9:97920996-97921018 CCTATACTGTGTAGACTTCTGAG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG No data
1057766131_1057766135 4 Left 1057766131 9:97921019-97921041 CCCTGGCTTCTGCGTTTTCCTTC 0: 1
1: 0
2: 5
3: 39
4: 367
Right 1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057766135 Original CRISPR CAAAATATGAGACCTGTAAT CGG Intronic
No off target data available for this crispr