ID: 1057767992

View in Genome Browser
Species Human (GRCh38)
Location 9:97940365-97940387
Sequence ATCTAGAAGCAGAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057767978_1057767992 27 Left 1057767978 9:97940315-97940337 CCTGCTACAACCTACCTAAGTCA 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767984_1057767992 -4 Left 1057767984 9:97940346-97940368 CCTGCCCCATGTTCCCTGTATCT 0: 1
1: 0
2: 0
3: 35
4: 318
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767985_1057767992 -8 Left 1057767985 9:97940350-97940372 CCCCATGTTCCCTGTATCTAGAA 0: 1
1: 1
2: 2
3: 16
4: 254
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767987_1057767992 -10 Left 1057767987 9:97940352-97940374 CCATGTTCCCTGTATCTAGAAGC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767983_1057767992 -3 Left 1057767983 9:97940345-97940367 CCCTGCCCCATGTTCCCTGTATC 0: 1
1: 0
2: 2
3: 20
4: 342
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767979_1057767992 17 Left 1057767979 9:97940325-97940347 CCTACCTAAGTCAATTCCACCCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767980_1057767992 13 Left 1057767980 9:97940329-97940351 CCTAAGTCAATTCCACCCCTGCC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767986_1057767992 -9 Left 1057767986 9:97940351-97940373 CCCATGTTCCCTGTATCTAGAAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767982_1057767992 -2 Left 1057767982 9:97940344-97940366 CCCCTGCCCCATGTTCCCTGTAT 0: 1
1: 0
2: 3
3: 32
4: 354
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data
1057767981_1057767992 1 Left 1057767981 9:97940341-97940363 CCACCCCTGCCCCATGTTCCCTG 0: 1
1: 1
2: 8
3: 100
4: 825
Right 1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057767992 Original CRISPR ATCTAGAAGCAGAGTGTGGA GGG Intronic
No off target data available for this crispr