ID: 1057768498

View in Genome Browser
Species Human (GRCh38)
Location 9:97944808-97944830
Sequence CAACCAGAAGTTATGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057768498 Original CRISPR CAACCAGAAGTTATGAAGAT AGG (reversed) Intronic
906371870 1:45260866-45260888 TAAACAAAAGTTGTGAAGATAGG - Intronic
907701756 1:56795466-56795488 CAACCAAAAGGACTGAAGATAGG - Intronic
909236725 1:73162067-73162089 CAACCAGAAGTTACGGAGGGTGG - Intergenic
909496703 1:76286716-76286738 CAACTGGGAATTATGAAGATTGG + Intronic
909773835 1:79459361-79459383 CAACATCAAGTTATGTAGATTGG - Intergenic
910217337 1:84855595-84855617 AAGCCAGAAGTTCTGAAGAAGGG + Intronic
915593622 1:156884200-156884222 CAACCTGAAGCTGTAAAGATCGG + Intergenic
919823526 1:201487978-201488000 AATCCAGAAGAGATGAAGATGGG + Intronic
920544358 1:206803111-206803133 CAAAAAGATGTTTTGAAGATTGG - Intronic
922943770 1:229492581-229492603 CAAGCAGAAGTGATAAAGTTTGG - Intronic
923412945 1:233727817-233727839 CAAGCAAAAGTTAAAAAGATTGG + Intergenic
1063230483 10:4061577-4061599 CTCCCAGAATCTATGAAGATAGG + Intergenic
1069190239 10:65478200-65478222 CAACCAATAGTTATGCAGGTGGG + Intergenic
1069860356 10:71467357-71467379 CAACCAGAAACTCTGAGGATCGG - Intronic
1070872576 10:79769846-79769868 CCACCAGAAGCTAAGAAGAGAGG - Intergenic
1071639498 10:87291995-87292017 CCACCAGAAGCTAAGAAGAGAGG - Intergenic
1071655737 10:87445957-87445979 CCACCAGAAGCTAAGAAGAGAGG + Intergenic
1074440884 10:113476622-113476644 CAACCAGGACTTCTAAAGATTGG - Intergenic
1075185590 10:120253606-120253628 CAACCCAAAGTTCTCAAGATAGG - Intergenic
1076175537 10:128365073-128365095 AAACCACAAGCTATGAAAATTGG + Intergenic
1076891539 10:133286831-133286853 CAAACAGAAATTATGACGCTAGG + Intronic
1078898584 11:15620804-15620826 CATCCAGAAAGTATGAAAATAGG - Intergenic
1078911474 11:15736633-15736655 CAATCAGAAGCTATGAGGATGGG + Intergenic
1079786850 11:24684096-24684118 TAAAGAGAAGTTTTGAAGATTGG - Intronic
1082759126 11:57109473-57109495 GAACCAGAAATTCTGAAGTTAGG - Intergenic
1085234232 11:75000327-75000349 AAATCAAAAGTTCTGAAGATTGG - Intronic
1087143946 11:94793434-94793456 CAATCAGAAGCTCTGAGGATAGG - Intronic
1087728630 11:101753116-101753138 CACGCAGAAGTAAGGAAGATGGG + Intronic
1088095334 11:106093582-106093604 GTACCTGAAGGTATGAAGATAGG + Intronic
1088125748 11:106421462-106421484 CAAAGCCAAGTTATGAAGATGGG + Intergenic
1088460913 11:110081840-110081862 TTATCAGAAGTTAAGAAGATTGG - Intergenic
1088723228 11:112612643-112612665 CACCCAGAAGTGATGAAGAAAGG - Intergenic
1093502654 12:19829734-19829756 CAATCACAAGTTTTGAAGACAGG - Intergenic
1094038556 12:26097825-26097847 AAACCAGAATGTGTGAAGATGGG + Intergenic
1095354991 12:41261979-41262001 CAGCCTGAAGTCCTGAAGATGGG + Intronic
1097622381 12:61955829-61955851 CAACCACAAGTTAAGTACATAGG + Intronic
1099270211 12:80499267-80499289 GAACCAGATATTAGGAAGATGGG - Intronic
1104460706 12:128953501-128953523 CAACAAGAAAATAGGAAGATTGG - Intronic
1105440467 13:20411146-20411168 CACCCAGAATATATCAAGATTGG - Intronic
1108607335 13:52052739-52052761 CCACCAGAAATTTTTAAGATGGG + Intronic
1111652670 13:91111798-91111820 CAATCACAAGTTATGAACATGGG - Intergenic
1113651967 13:112039879-112039901 AAACCAGGAGTTATGGAGACTGG - Intergenic
1121427784 14:93865027-93865049 CAACTAGAACTTCTAAAGATAGG + Intergenic
1125204168 15:37132618-37132640 CAAACAAAAGATATGAAGTTTGG - Intergenic
1127865254 15:63027476-63027498 CACCCAAAAATTATGCAGATTGG + Intergenic
1128155814 15:65391248-65391270 CAACCAGAAGCCATGAAGCTTGG - Intronic
1128195000 15:65745549-65745571 CAAGCAGATATTATGAATATAGG + Intronic
1130207165 15:81887843-81887865 CATCCAGAACGTATGAAGAAGGG + Intergenic
1133492152 16:6280648-6280670 TAGCCAGAAGTAATTAAGATAGG + Intronic
1133592164 16:7256343-7256365 CTACCAGAAGTTCTGAGGTTTGG + Intronic
1138434241 16:56988480-56988502 CAACCAGGAGTGGTGAAGCTGGG + Intergenic
1141043255 16:80690534-80690556 CACCCAGAAGTTATGGACTTTGG + Intronic
1142309244 16:89302664-89302686 AAACAAGAAGTTATTAAAATTGG + Intronic
1144128459 17:12223609-12223631 CAACCACAAATTATGATGAATGG - Intergenic
1147652253 17:42069308-42069330 CAACCAGAAGTGGTGGAGATGGG - Intergenic
1148384963 17:47227897-47227919 CAACCATAATTTATGGAAATAGG + Intergenic
1149300044 17:55296866-55296888 CACCCAGAAGATCTGAAAATGGG - Intronic
1149351816 17:55796778-55796800 CAACCATAATTAATTAAGATGGG + Intronic
1149890771 17:60388812-60388834 CACCTAGAAATTAGGAAGATTGG - Intronic
1150529927 17:65966626-65966648 CAACCAGCAGCCATGAATATAGG - Intronic
1151847393 17:76666828-76666850 CAACCTGAAAATATGCAGATTGG - Intergenic
1154496259 18:14963512-14963534 GAACCAGAACTTAGGAAGGTAGG - Intergenic
1155336833 18:24773592-24773614 CAACCAGAAGCTATGATGTATGG + Intergenic
1155552808 18:26983659-26983681 AAATCAGAAATTCTGAAGATGGG - Intronic
1159731227 18:72031565-72031587 CAAGCAGAAGTTCTGGAGCTGGG - Intergenic
1160135015 18:76264497-76264519 CCACCAGAAGTTGCCAAGATGGG - Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
926443969 2:12921483-12921505 CAACCAGAAATTATGAGGCCTGG - Intergenic
928867739 2:35937570-35937592 CCACCCGAAGTAAAGAAGATAGG - Intergenic
928996383 2:37296174-37296196 AAACCAGAAGTTCTGAATAATGG + Intronic
931184509 2:59937102-59937124 CCACCATAAGTCAGGAAGATAGG - Intergenic
933046994 2:77551511-77551533 CAATCAGAAGTTCTGAAAATGGG + Intronic
933053147 2:77626624-77626646 CACCCAGAATTTATAAAGAAAGG - Intergenic
936797222 2:116221885-116221907 CAAGCAGAAGTCATGAAAATCGG - Intergenic
937657509 2:124393459-124393481 CAAGCAGAAGGTTTGCAGATAGG + Intronic
938062637 2:128264896-128264918 CAACCAGAAGATCTGGATATTGG + Intronic
939796621 2:146653611-146653633 CAAGCAGAAATCATGAAAATGGG + Intergenic
939811258 2:146835592-146835614 CATGCAGAAGTTATGTAGGTGGG + Intergenic
941253214 2:163193855-163193877 CAACCTGAAAATATGAAAATAGG + Intergenic
944554410 2:200873525-200873547 CAACAAGAAGTAATAAAAATAGG + Intronic
945356116 2:208841743-208841765 CTAACAGAAGTGATGAAGAATGG + Intronic
947898941 2:233703640-233703662 CAACCAAAAGAAATGCAGATTGG - Intronic
948061697 2:235047167-235047189 CAACAAGAATTTATGGATATTGG + Intronic
1169751216 20:8996611-8996633 CAATCAGAATCTCTGAAGATGGG + Intergenic
1170032088 20:11954647-11954669 CACCCAGAAGTTATGAGCAGAGG - Intergenic
1171192086 20:23165949-23165971 CAACAGGAATTTGTGAAGATCGG + Intergenic
1177571867 21:22897653-22897675 CCACCAGAAGCTAGGAAGCTTGG - Intergenic
1177866863 21:26522810-26522832 CTGCCAGAAGTTATTAAGACTGG + Intronic
1178010885 21:28285495-28285517 CAATCAGTAGTTATGAACAATGG + Intergenic
1178737188 21:35162870-35162892 AGATCAGAAGTTATGAGGATGGG - Intronic
1179021094 21:37641852-37641874 AGAACAGAAGTGATGAAGATAGG + Intronic
1181163424 22:20970965-20970987 CAGCCAGAAGTCATGGAGCTGGG + Intronic
1183054238 22:35292758-35292780 CACTCAGAAGGTAAGAAGATGGG + Intronic
949481863 3:4501900-4501922 CATCCAGAAGTTCTGCTGATGGG - Intronic
950020823 3:9786483-9786505 CAACCAGCAGGTATAAAGACAGG + Intronic
952517780 3:34123076-34123098 CAACAAGAAGTTAAAAAGCTAGG - Intergenic
953642108 3:44718251-44718273 CAACCAGAATGAATGAATATTGG - Intronic
954152836 3:48666493-48666515 AAATAATAAGTTATGAAGATTGG + Intergenic
954189148 3:48943994-48944016 CAACCAAAAGAAATGCAGATGGG - Intronic
956411478 3:68984430-68984452 CAACTAGAAGTCATGAAAAAGGG - Intronic
956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG + Intergenic
957126571 3:76169300-76169322 CAAACACAAGCTATGAAAATTGG + Intronic
958555142 3:95663531-95663553 TAACCAGAAGTGATCCAGATCGG - Intergenic
959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG + Intergenic
960112012 3:113854358-113854380 CCACCTGAAGTTTTGAACATTGG - Intronic
961509286 3:127391227-127391249 CAACCAAAAGTTATCAGAATTGG + Intergenic
964015621 3:151942427-151942449 CAACAGGAACTTATGAATATTGG - Intergenic
966811559 3:183850274-183850296 CCACCAGAAGCTAGGAAGAGGGG - Intronic
970107805 4:12604704-12604726 CAAGCAGAACTTATAATGATTGG - Intergenic
970664998 4:18326625-18326647 CAAGCAGAAGTAAAGGAGATTGG + Intergenic
974724769 4:65784450-65784472 CAGCCAGAATTTATTAAGATAGG - Intergenic
975343785 4:73271055-73271077 AAACCAGAGATTATTAAGATTGG - Intergenic
975525379 4:75343154-75343176 CAACCAGATGTGATAAATATGGG + Intergenic
977537492 4:98271974-98271996 GAACCAGAACTTCTGAAGGTGGG - Intronic
978554068 4:109959645-109959667 GAAACACAAGATATGAAGATAGG - Intronic
980097418 4:128505651-128505673 AAACCAGAAGTTAATGAGATTGG - Intergenic
981791188 4:148538534-148538556 CAACCACAATTTATGAAAACTGG + Intergenic
982767802 4:159368287-159368309 CATCCAGAAGTTCTCAAGAGAGG + Intergenic
983706621 4:170668020-170668042 CTAACAGAAATTATGAACATTGG - Intergenic
984225325 4:177027990-177028012 CAAGCATGAGCTATGAAGATTGG - Intergenic
987168371 5:15225050-15225072 AAGACAGAAGTTATGAAGAGTGG - Intergenic
987756690 5:22105775-22105797 CAAACTGAGGTTATTAAGATAGG - Intronic
988452217 5:31354830-31354852 CAACCAGAAATTTTAAAGATGGG - Intergenic
988666355 5:33332367-33332389 CATACTGAAGTTATTAAGATAGG + Intergenic
992917505 5:81473452-81473474 CAACAAGAATTTATGAACACAGG - Intronic
996232057 5:121077733-121077755 CAATCAGAAGTCAAAAAGATAGG + Intergenic
997334426 5:133095790-133095812 CAAGATGAAGTTCTGAAGATTGG - Intronic
997939535 5:138144470-138144492 CAAATGGAAGTTATGAACATTGG - Intronic
998351251 5:141503107-141503129 CTACCAGAGGGTATGAAGAGAGG - Intronic
998509897 5:142703092-142703114 CAAGAAGAGCTTATGAAGATTGG - Intergenic
998536658 5:142938904-142938926 CAGCCACAAGTTTTGAAGGTTGG + Intronic
999955233 5:156693940-156693962 CAATAAGAAGTAATGAAGAATGG - Intronic
1000015331 5:157270815-157270837 AAACCAGAAGTTAAGAATTTTGG + Intronic
1000641688 5:163710577-163710599 GTACCAGAATTTATGAAGACTGG + Intergenic
1001517763 5:172367783-172367805 CAACCAGTAGTAATGAGGAAAGG - Intronic
1003129081 6:3379756-3379778 CAAACAGAAGTCATGCAGCTGGG + Intronic
1004348564 6:14870695-14870717 AACTAAGAAGTTATGAAGATTGG + Intergenic
1004762584 6:18685645-18685667 CACCAAGAAGGTATGCAGATGGG - Intergenic
1005758313 6:28945300-28945322 AAACAAGAAGTGAAGAAGATAGG + Intergenic
1007545667 6:42691983-42692005 CAACCAGATCTTATGAAGGAAGG - Exonic
1008040433 6:46792007-46792029 CAACAAGAAGGTAAGAAAATAGG - Intergenic
1009482509 6:64177032-64177054 AAAACATAAGTTATGAAGAATGG + Intronic
1010359077 6:74971650-74971672 CAACCATAAATTATGTTGATGGG - Intergenic
1013482982 6:110568087-110568109 CATGCAGCAGTTAAGAAGATAGG - Intergenic
1014187265 6:118449204-118449226 CAGCCAGAAGTTATCAAAACTGG - Intergenic
1015296501 6:131599310-131599332 CTACCAGGAGTTATGAAAAATGG + Intronic
1016227256 6:141753590-141753612 CAACAAGAACTCATCAAGATGGG - Intergenic
1016238667 6:141901262-141901284 AAAACAGAAGGTATGCAGATAGG - Intergenic
1017551122 6:155508659-155508681 TAACAAGCAGTTCTGAAGATTGG - Intergenic
1018159544 6:161025040-161025062 CACCCAGTAGTTATCAATATGGG + Intronic
1020613587 7:10430647-10430669 CAAACAGAAGTGATTAATATGGG + Intergenic
1023615950 7:42019910-42019932 TGACCAGAAGCTAAGAAGATAGG - Intronic
1024342824 7:48284356-48284378 CAATTAGATGTTATGAACATTGG + Intronic
1027933264 7:84567787-84567809 CAACCAGAAGCTAGGAAAAAGGG + Intergenic
1029054465 7:97726847-97726869 CAAATAAAAGTTATGAAAATAGG - Intergenic
1031768162 7:125807061-125807083 TCACCAGAAGTTATGAATAGAGG - Intergenic
1031997997 7:128245512-128245534 CAACTTGGAGTTATGAAGAAAGG + Intronic
1035951669 8:4029193-4029215 CAACGAGAGGTGATGAAAATAGG + Intronic
1037591925 8:20319904-20319926 GAACCAGAAGCTCTGAGGATGGG + Intergenic
1044461488 8:92449869-92449891 AAACCAGAAGTTTTAGAGATTGG - Intergenic
1046182119 8:110664157-110664179 TTACCAGAGGTTAGGAAGATAGG - Intergenic
1046954243 8:120046861-120046883 CAGCCAGGTGTTAGGAAGATAGG + Intronic
1047600876 8:126424817-126424839 CAAAAAGAAGCTAGGAAGATGGG - Intergenic
1048745084 8:137605573-137605595 CAGCCTGAGGTTCTGAAGATAGG + Intergenic
1049906991 9:227242-227264 CAATGAGAAATTATGAAAATTGG + Intronic
1050641986 9:7678094-7678116 GAATTAGAATTTATGAAGATGGG + Intergenic
1052423509 9:28274024-28274046 CAACCAGAAGAAGAGAAGATGGG + Intronic
1052703955 9:31971604-31971626 CACCTAGAAATTAGGAAGATTGG - Intergenic
1052776941 9:32741801-32741823 CAACCAGAAGTCATTAAGCTCGG + Intergenic
1056260806 9:84846540-84846562 CTACAAGCAGTTATAAAGATTGG + Intronic
1056831775 9:89923174-89923196 CAACCTGGAGTCATGAAGCTTGG + Intergenic
1057768498 9:97944808-97944830 CAACCAGAAGTTATGAAGATAGG - Intronic
1058593015 9:106585193-106585215 CCACAGGAAGTTGTGAAGATGGG - Intergenic
1060534919 9:124377782-124377804 CAGAGAGAAGCTATGAAGATAGG - Intronic
1187837805 X:23453471-23453493 TAACCAGAATATATGAAGAATGG - Intergenic
1187957161 X:24530632-24530654 TAACCAGAAGTGAGGAAGCTTGG + Intronic
1188835033 X:34944823-34944845 CAATCAGAATTTATGATGACTGG + Exonic
1189040797 X:37541001-37541023 CAATCAGAATTTATGATGACTGG - Intronic
1189528040 X:41847340-41847362 GAACCAGAAGACATGAAGATAGG - Intronic
1191883024 X:65860968-65860990 CAAACAGAAGGGATGAATATTGG + Intergenic
1192899344 X:75478878-75478900 AAACCAGAAGGTAAGAATATTGG - Exonic
1193390331 X:80919669-80919691 CAATCCCCAGTTATGAAGATGGG + Intergenic
1193689025 X:84616813-84616835 CAACTAGGAGTTATGATGAATGG - Intergenic
1196154238 X:112409251-112409273 CAACCAAAAGTTAAAAAGCTTGG + Intergenic
1197939255 X:131772271-131772293 GTACCAGAAGTTAGGAAGAGAGG - Intergenic
1198064832 X:133085921-133085943 CATCCAGAAGATGTGTAGATGGG + Intronic
1198601491 X:138288693-138288715 CAACCACAAGTGATCAAGAAGGG - Intergenic
1198728610 X:139703066-139703088 TTACAAGAAGTTCTGAAGATTGG - Intronic