ID: 1057769353

View in Genome Browser
Species Human (GRCh38)
Location 9:97953624-97953646
Sequence GTGGATTGACTTGTAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057769353_1057769354 -10 Left 1057769353 9:97953624-97953646 CCTTTGTTTACAAGTCAATCCAC No data
Right 1057769354 9:97953637-97953659 GTCAATCCACCTCATCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057769353 Original CRISPR GTGGATTGACTTGTAAACAA AGG (reversed) Intergenic
No off target data available for this crispr