ID: 1057772848

View in Genome Browser
Species Human (GRCh38)
Location 9:97983449-97983471
Sequence CCGTCGGAAGGGTTTGCTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057772848_1057772854 -3 Left 1057772848 9:97983449-97983471 CCGCTAGCAAACCCTTCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772848_1057772859 27 Left 1057772848 9:97983449-97983471 CCGCTAGCAAACCCTTCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1057772859 9:97983499-97983521 TCCCCCCTCCGCCCCCGCCGCGG 0: 1
1: 0
2: 5
3: 87
4: 628
1057772848_1057772853 -4 Left 1057772848 9:97983449-97983471 CCGCTAGCAAACCCTTCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1057772853 9:97983468-97983490 ACGGCCCTCGCTGCGCAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057772848 Original CRISPR CCGTCGGAAGGGTTTGCTAG CGG (reversed) Exonic