ID: 1057772854

View in Genome Browser
Species Human (GRCh38)
Location 9:97983469-97983491
Sequence CGGCCCTCGCTGCGCAAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057772844_1057772854 10 Left 1057772844 9:97983436-97983458 CCGCCGGCCTCCGCCGCTAGCAA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772845_1057772854 7 Left 1057772845 9:97983439-97983461 CCGGCCTCCGCCGCTAGCAAACC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772842_1057772854 21 Left 1057772842 9:97983425-97983447 CCAGGACCGCGCCGCCGGCCTCC 0: 1
1: 1
2: 5
3: 33
4: 410
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772838_1057772854 28 Left 1057772838 9:97983418-97983440 CCGCCACCCAGGACCGCGCCGCC 0: 2
1: 0
2: 1
3: 22
4: 316
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772848_1057772854 -3 Left 1057772848 9:97983449-97983471 CCGCTAGCAAACCCTTCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772847_1057772854 0 Left 1057772847 9:97983446-97983468 CCGCCGCTAGCAAACCCTTCCGA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772843_1057772854 15 Left 1057772843 9:97983431-97983453 CCGCGCCGCCGGCCTCCGCCGCT 0: 1
1: 0
2: 8
3: 69
4: 565
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772846_1057772854 3 Left 1057772846 9:97983443-97983465 CCTCCGCCGCTAGCAAACCCTTC 0: 1
1: 0
2: 1
3: 1
4: 65
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772840_1057772854 25 Left 1057772840 9:97983421-97983443 CCACCCAGGACCGCGCCGCCGGC 0: 2
1: 0
2: 1
3: 17
4: 267
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772841_1057772854 22 Left 1057772841 9:97983424-97983446 CCCAGGACCGCGCCGCCGGCCTC 0: 2
1: 0
2: 1
3: 19
4: 148
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1057772837_1057772854 29 Left 1057772837 9:97983417-97983439 CCCGCCACCCAGGACCGCGCCGC 0: 2
1: 0
2: 1
3: 24
4: 195
Right 1057772854 9:97983469-97983491 CGGCCCTCGCTGCGCAAGCCGGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057772854 Original CRISPR CGGCCCTCGCTGCGCAAGCC GGG Exonic